Cart 2 Product Products 216,18 € (empty)
-
1 x C21orf49-c...113,40 € -
No products
To be determined Shipping
216,18 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 216,18 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 216,18 €
View larger 
GREM2-gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) Gene
PTXBC046632
New product
Data sheet of GREM2-gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GREM2-gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC046632 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GREM2 |
| Origin species: | Human |
| Product name: | GREM2-gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC046632 |
| Gene id: | 64388 |
| Gene description: | gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis) |
| Synonyms: | CKTSF1B2; DAND3; PRDC; gremlin-2; DAN domain family member 3; cysteine knot superfamily 1, BMP antagonist 2; gremlin 2, cysteine knot superfamily, homolog; protein related to DAN and cerberus; gremlin 2, DAN family BMP antagonist |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttctggaagctttccctgtccttgttcatggtggcggtgctggtgaaggtggcggaagcccggaagaaccggccggcgggcgccatccactcgccttacaaggacggcagcagcaacaactcggagagatggcagcaccagatcaaggaggtactggcctccagccaggaggccctggtggtcaccgagcgcaagtacctcaagagtgactggtgcaagacgcagccgctgcggcagacggtgagcgaggagggctgccggagccgcaccatcctcaaccgcttctgctacggccagtgcaactccttctacatcccgcggcacgtgaagaaggaggaggagtccttccagtcctgcgccttctgcaagccccagcgcgtcacctccgtcctcgtggagctcgagtgccccggcctggacccacccttccgactcaagaaaatccagaaggtgaagcagtgccggtgcatgtccgtgaacctgagcgactcggacaagcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 9 (sodium/hydrogen exchanger), member 6 - similar to Six transmembrane epithelial antigen of prostate - potassium inwardly-rectifying channel, subfamily J, member 12 - egf-like module containing, mucin-like, hormone receptor-like 1 |