PTXBC047381
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC047381 |
Product type: | DNA & cDNA |
Ncbi symbol: | CIB2 |
Origin species: | Human |
Product name: | CIB2-calcium and integrin binding family member 2 Gene |
Size: | 2ug |
Accessions: | BC047381 |
Gene id: | 10518 |
Gene description: | calcium and integrin binding family member 2 |
Synonyms: | DFNB48; KIP2; USH1J; calcium and integrin-binding family member 2; DNA-dependent protein kinase catalytic subunit-interacting protein 2; calcium and integrin binding family member 2 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggggaacaagcagaccatcttcaccgaagagcagctagacaactaccaggactgcaccttcttcaataagaaggacatcctcaagctgcattcgcgattctatgagctggcccccaacctcgtcccaatggactacaggaagagccccatcgtccacgtgcccatgagcctcatcatccagatgccagagctccgggagaatcccttcaaagaaaggatcgtggcggcgttttccgaggatggtgaggggaacctcactttcaacgactttgtggacatgttttccgtgctctgcgagtcggctccccgagagctcaaggcaaactatgccttcaagatctatgacttcaacactgacaacttcatctgcaaggaggacctggagctgacgctggcccggctcactaagtcagagctggatgaggaggaggtggtgcttgtgtgcgacaaggtcattgaggaggctgacttggatggtgacggcaagctgggctttgctgacttcgaggacatgattgccaaggcccctgacttcctcagcactttccacatccggatctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - heat shock transcription factor, Y-linked 1 - glutamate-cysteine ligase, catalytic subunit - proline rich Gla (G-carboxyglutamic acid) 1 - Morf4 family associated protein 1-like 1 |