Cart 3 Product Products 318,96 € (empty)
-
-
-
1 x CMC1-COX...113,40 €
No products
To be determined Shipping
318,96 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 318,96 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 318,96 €
View larger 
Data sheet of DNAJC4-DnaJ (Hsp40) homolog, subfamily C, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJC4-DnaJ (Hsp40) homolog, subfamily C, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC044584 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJC4 |
| Origin species: | Human |
| Product name: | DNAJC4-DnaJ (Hsp40) homolog, subfamily C, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC044584 |
| Gene id: | 3338 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily C, member 4 |
| Synonyms: | DANJC4; HSPF2; MCG18; dnaJ homolog subfamily C member 4; DnaJ (Hsp40) homolog, subfamily C, member 4; dnaJ-like protein HSPF2; heat shock 40kD protein 2; multiple endocrine neoplasia type 1 candidate protein number 18; DnaJ heat shock protein family (Hsp40) member C4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgcccttactgcccctgcgcctgtgccggctgtggccccgcaaccctccctcccggctcctcggagcggccgccgggcagcggtccagacccagtacttattatgaactgttgggggtgcatcctggtgccagcactgaggaagttaaacgagctttcttctccaagtccaaagagctgcacccagaccgggaccctgggaacccaagcctgcacagccgctttgtggagctgagcgaggcataccgtgtgctcagccgtgagcagagccgccgcagctatgatgaccagctccgctcaggtagtcccccaaagtctccacgaaccacagtccatgacaagtctgcccaccaaacacacagctcctggacaccccccaacgcacagtactggtcccagtttcacagcgtgaggccacaggggccccagttgaggcagcagcaacacaaacaaaacaaacaagtgctggggtactgcctcctcctcatgctggcgggcatgggcctgcactacattgccttcaggaaggtgaagcagatgcaccttaacttcatggatgaaaaggatcggatcatcacagccttctacaacgaagcccgggcacgggccagggccaacagaggcatccttcagcaggagcgacaacggctagggcagcggcagccgccaccatccgagccaacccaaggccccgagatcgtgccccggggcgccggcccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - preferentially expressed antigen in melanoma - mitochondrial carrier homolog 1 (C. elegans) - melanoma inhibitory activity family, member 3 - ARP3 actin-related protein 3 homolog (yeast) |