Cart 1 Product Products 121,50 € (empty)
-
1 x PLEKHO1-pl...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of PRND-prion protein 2 (dublet) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRND-prion protein 2 (dublet) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC043644 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRND |
| Origin species: | Human |
| Product name: | PRND-prion protein 2 (dublet) Gene |
| Size: | 2ug |
| Accessions: | BC043644 |
| Gene id: | 23627 |
| Gene description: | prion protein 2 (dublet) |
| Synonyms: | DOPPEL; DPL; PrPLP; dJ1068H6.4; prion-like protein doppel; prion gene complex, downstream; prion protein 2 (dublet) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggaagcacctgagctggtggtggctggccactgtctgcatgctgctcttcagccacctctctgcggtccagacgaggggcatcaagcacagaatcaagtggaaccggaaggccctgcccagcactgcccagatcactgaggcccaggtggctgagaaccgcccgggagccttcatcaagcaaggccgcaagctcgacattgacttcggagccgagggcaacaggtactacgaggccaactactggcagttccccgatggcatccactacaacggctgctctgaggctaatgtgaccaaggaggcatttgtcaccggctgcatcaatgccacccaggcggcgaaccagggggagttccagaagccagacaacaagctccaccagcaggtgctctggcggctggtccaggagctctgctccctcaagcattgcgagttttggttggagaggggcgcaggacttcgggtcaccatgcaccagccagtgctcctctgccttctggctttgatctggctcatggtgaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SH3-domain GRB2-like 3 - deleted in azoospermia 4 - neuromedin U receptor 1 - CTAGE family, member 6 |