Cart 4 Product Products 467,28 € (empty)
-
-
1 x TRIP13-thy...121,50 € -
1 x ELOVL2-elo...121,50 € -
1 x NXPH4-neur...121,50 €
No products
To be determined Shipping
467,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 467,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 467,28 €
View larger 
GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene
PTXBC011836
New product
Data sheet of GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011836 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPX4 |
| Origin species: | Human |
| Product name: | GPX4-glutathione peroxidase 4 (phospholipid hydroperoxidase) Gene |
| Size: | 2ug |
| Accessions: | BC011836 |
| Gene id: | 2879 |
| Gene description: | glutathione peroxidase 4 (phospholipid hydroperoxidase) |
| Synonyms: | GPx-4; GSHPx-4; MCSP; PHGPx; SMDS; snGPx; snPHGPx; phospholipid hydroperoxide glutathione peroxidase, mitochondrial; phospholipid hydroperoxide glutathione peroxidase; phospholipid hydroperoxidase; sperm nucleus glutathione peroxidase; glutathione peroxidase 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcctcggccgcctttgccgcctactgaagccggcgctgctctgtggggctctggccgcgcctggcctggccgggaccatgtgcgcgtcccgggacgactggcgctgtgcgcgctccatgcacgagttttccgccaaggacatcgacgggcacatggttaacctggacaagtaccggggcttcgtgtgcatcgtcaccaacgtggcctcccagtgaggcaagaccgaagtaaactacactcagctcgtcgacctgcacgcccgatacgctgagtgtggtttgcggatcctggccttcccgtgtaaccagttcgggaagcaggagccagggagtaacgaagagatcaaagagttcgccgcgggctacaacgtcaaattcgatatgttcagcaagatctgcgtgaacggggacgacgcccacccgctgtggaagtggatgaagatccaacccaagggcaagggcatcctgggaaatgccatcaagtggaacttcaccaagttcctcatcgacaagaacggctgcgtggtgaagcgctacggacccatggaggagcccctggtgatagagaaggacctgccccactatttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 4, subfamily V, polypeptide 2 - SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) - ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 - ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 |