Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of H3F3A-H3 histone, family 3A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about H3F3A-H3 histone, family 3A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029405 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | H3F3A |
| Origin species: | Human |
| Product name: | H3F3A-H3 histone, family 3A Gene |
| Size: | 2ug |
| Accessions: | BC029405 |
| Gene id: | 3020 |
| Gene description: | H3 histone, family 3A |
| Synonyms: | H3.3A; H3F3; histone H3.3; H3 histone, family 3A; H3 histone family member 3A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcgtacaaagcagactgcccgcaaatcgaccggtggtaaagcacccaggaagcaactggctacaaaagccgctcgcaagagtgcgccctctactggaggggtgaagaaacctcatcgttacaggcctggtactgtggcgctccgtgaaattagacgttatcagaagtccactgaacttctgattcgcaaacttcccttccagcgtctggtgcgagaaattgctcaggactttaaaacagatctgcgcttccagagcgcagctatcggtgctttgcaggaggcaagtgaggcctatctggttggcctttttgaagacaccaacctgtgtgctatccatgccaaacgtgtaacaattatgccaaaagacatccagctagcacgccgcatacgtggagaacgtgcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PHD finger protein 13 - transducer of ERBB2, 2 - hect domain and RLD 3 - USP6 N-terminal like |