Cart 7 Product Products 813,78 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
-
1 x NPTN-neuro...121,50 € -
1 x LIPA-lipas...121,50 € -
-
1 x PSMB10-pro...121,50 €
No products
To be determined Shipping
813,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 813,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 813,78 €
View larger 
DTD1-D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) Gene
PTXBC045167
New product
Data sheet of DTD1-D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DTD1-D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC045167 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DTD1 |
| Origin species: | Human |
| Product name: | DTD1-D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC045167 |
| Gene id: | 92675 |
| Gene description: | D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) |
| Synonyms: | C20orf88; DUE-B; DUEB; HARS2; pqn-68; D-tyrosyl-tRNA(Tyr) deacylase 1; D-tyrosyl-tRNA deacylase 1 homolog; DNA-unwinding element-binding protein B; histidyl-tRNA synthase-related; histidyl-tRNA synthetase 2; D-tyrosyl-tRNA deacylase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggccgtggtgcagcgcgtcacccgggccagcgtcacagttggaggagagcagattagtgccattggaaggggcatatgtgtgttgctgggtatttccctggaggatacgcagaaggaactggaacacatggtccgaaagattctaaacctgcgtgtatttgaggatgagagtgggaagcactggtcgaagagtgtgatggacaaacagtacgagattctgtgtgtcagccagtttaccctccagtgtgtcctgaagggaaacaagcctgatttcaacctagcaatgcccacggagcaggcagagggcttctacaacagcttcctggagcagctgcgtaaaacatacaggccggagcttatcaaagatggcaagtttggggcctacatgcaggtgcacattcagaatgatgggcctgtgaccatagagctggaatcgccagctcccggcactgctacctctgacccaaagcagctgtcaaagctcgaaaaacagcagcagaggaaagaaaagaccagagctaagggaccttctgaatcaagcaaggaaagaaacactccccgaaaagaagaccgcagtgccagcagcggggctgagggcgacgtgtcctctgaacgggagccgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 - C1q and tumor necrosis factor related protein 9 - sphingomyelin phosphodiesterase 1, acid lysosomal - major facilitator superfamily domain containing 1 |