Cart 20 Product Products 3 200,82 € (empty)
-
1 x C12orf45-c...113,40 € -
1 x OPRS1-opio...113,40 € -
1 x C9orf16-ch...113,40 € -
1 x CDCA5-cell...113,40 € -
1 x PIM2-pim-2...121,50 € -
1 x C5orf46-ch...113,40 € -
1 x MBD5-methy...113,40 € -
1 x STX12-synt...121,50 € -
1 x GSTM3-glut...113,40 € -
1 x SIGLEC6-si...121,50 € -
1 x ICT1-immat...113,40 € -
1 x STAC-SH3...121,50 € -
1 x SLC25A41-s...113,40 € -
1 x MC4-R...259,07 € -
-
1 x Procalcitonin544,00 € -
-
1 x MLF1-myelo...121,50 € -
1 x BMS1P5-BMS...113,40 € -
1 x Interleukin-8444,00 €
No products
To be determined Shipping
3 200,82 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 20 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 200,82 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 200,82 €
Data sheet of FFAR3-free fatty acid receptor 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FFAR3-free fatty acid receptor 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035657 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FFAR3 |
| Origin species: | Human |
| Product name: | FFAR3-free fatty acid receptor 3 Gene |
| Size: | 2ug |
| Accessions: | BC035657 |
| Gene id: | 2865 |
| Gene description: | free fatty acid receptor 3 |
| Synonyms: | FFA3R; GPR41; GPR42; free fatty acid receptor 3; G-protein coupled receptor 41 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatacaggccccgaccagtcctacttctccggcaatcactggttcgtcttctcggtgtaccttctcactttcctggtggggctccccctcaacctgctggccctggtggtcttcgtgggcaagctgcagcgccgcccggtggccgtggacgtgctcctgctcaacctgaccgcctcggacctgctcctgctgctgttcctgcctttccgcatggtggaggcagccaatggcatgcactggcccctgcccttcatcctctgcccactctctggattcatcttcttcaccaccatctatctcaccgccctcttcctggcagctgtgagcattgaacgcttcctgagtgtggcccacccactgtggtacaagacccggccgaggctggggcaggcaggtctggtgagtgtggcctgctggctgttggcctctgctcactgcagcgtggtctacgtcatagaattctcaggggacatctcccacagccagggcaccaatgggacctgctacctggagttccggaaggaccagctagccatcctcctgcccgtgcggctggagatggctgtggtcctctttgtggtcccgctgatcatcaccagctactgctacagccgcctggtgtggatcctcggcagagggggcagccaccgccggcagaggagggtggcggggctgttggcggccacgctgctcaacttccttgtctgctttgggccctacaacgtgtcccatgtcgtgggctatatctgcggtgaaagcccggcgtggaggatctacgtgacgcttctcagcaccctgaactcctgtgtcgacccctttgtctactacttctcctcctccgggttccaagccgactttcatgagctgctgaggaggttgtgtgggctctggggccagtggcagcaggagagcagcatggagctgaaggagcagaagggaggggaggagcagagagcggaccgaccagctgaaagaaagaccagtgaacactcacagggctgtggaactggtggccaggtggcctgtgctgaaagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gamma-glutamyltransferase 5 - CXXC finger 1 (PHD domain) - ankyrin repeat domain 10 - ankyrin repeat domain 39 |