SOSTDC1-sclerostin domain containing 1 Gene View larger

SOSTDC1-sclerostin domain containing 1 Gene

PTXBC008484

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SOSTDC1-sclerostin domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SOSTDC1-sclerostin domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008484
Product type: DNA & cDNA
Ncbi symbol: SOSTDC1
Origin species: Human
Product name: SOSTDC1-sclerostin domain containing 1 Gene
Size: 2ug
Accessions: BC008484
Gene id: 25928
Gene description: sclerostin domain containing 1
Synonyms: CDA019; DAND7; ECTODIN; USAG1; sclerostin domain-containing protein 1; cystine-knot containing secreted protein; ectodermal BMP inhibitor; uterine sensitization-associated protein-1; wise; sclerostin domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttcctcctgccattcatttctatctccttccccttgcatgcatcctaatgaaaagctgtttggcttttaaaaatgatgccacagaaatcctttattcacatgtggttaaacctgttccagcacaccccagcagcaacagcacgttgaatcaagccagaaatggaggcaggcatttcagtaacactggactggatcggaacactcgggttcaagtgggttgccgggaactgcgttccaccaaatacatctctgatggccagtgcaccagcatcagccctctgaaggagctggtgtgtgctggcgagtgcttgcccctgccagtgctccctaactggattggaggaggctatggaacaaagtactggagcaggaggagctcccaggagtggcggtgtgtcaatgacaaaacccgtacccagagaatccagctgcagtgccaagatggcagcacacgcacctacaaaatcacagtagtcactgcctgcaagtgcaagaggtacacccggcagcacaacgagtccagtcacaactttgagagcatgtcacctgccaagccagtccagcatcacagagagcggaaaagagccagcaaatccagcaagcacagcatgagttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ras homolog gene family, member C
- T cell receptor delta variable 2
- coactosin-like 1 (Dictyostelium)
- blood vessel epicardial substance

Reviews

Buy SOSTDC1-sclerostin domain containing 1 Gene now

Add to cart