Cart 15 Product Products 2 429,84 € (empty)
-
1 x FLJ20628-h...121,50 € -
1 x Centriolin...259,07 € -
1 x ARHGAP15-R...121,50 € -
1 x PCLO-picco...113,40 € -
1 x KIAA0040-K...113,40 € -
1 x ARHGEF18-r...113,40 € -
1 x BTLA-B and...113,40 € -
1 x RIN1...259,07 € -
1 x NR5A2-nucl...121,50 € -
1 x CTSZ-cathe...121,50 € -
-
1 x Decorin544,00 € -
1 x SFXN3-side...121,50 € -
1 x CRLF3-cyto...121,50 € -
1 x AKAP7-A...113,40 €
No products
To be determined Shipping
2 429,84 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 15 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 429,84 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 429,84 €
Data sheet of RNF41-ring finger protein 41 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNF41-ring finger protein 41 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032637 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNF41 |
| Origin species: | Human |
| Product name: | RNF41-ring finger protein 41 Gene |
| Size: | 2ug |
| Accessions: | BC032637 |
| Gene id: | 10193 |
| Gene description: | ring finger protein 41 |
| Synonyms: | FLRF; NRDP1; SBBI03; E3 ubiquitin-protein ligase NRDP1; fetal liver ring finger; neuregulin receptor degradation protein-1; ring finger protein 41, E3 ubiquitin protein ligase; ring finger protein 41 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggtatgatgtaacccgtttccagggggatgttgacgaagatcttatctgccctatttgcagtggagtcttggaggagccagtacaggcacctcattgtgaacatgctttctgcaacgcctgcatcacccagtggttctctcagcaacagacatgtccagtggaccgtagtgttgtgacggtcgcccatctgcgcccagtacctcggatcatgcggaacatgttgtcaaagctgcagattgcctgtgacaacgctgtgttcggctgtagtgccgttgtccggcttgacaacctcatgtctcacctcagcgactgtgagcacaacccgaagcggcctgtgacctgtgaacagggctgtggcctggagatgcccaaagatgagctgcccaaccataactgcattaagcacctgcgctcagtggtacagcagcagcagacacgcatcgcagagctggagaagacgtcagctgaacacaaacaccagctggcggagcagaagcgagacatccagctgctaaaggcatacatgcgtgcaatccgcagtgtcaaccccaaccttcagaacctggaggagacaattgaatacaacgagatcctagagtgggtgaactcccttcagccagcaagagtgacccgctggggagggatgatctcgactcctgatgctgtgctccaggctgtaatcaagcgctccctggtggagagtggctgtcctgcttctattgtcaacgagctgattgaaaatgcccacgagcgtagctggccccagggtctggccacactagagactagacagatgaaccgacgctactatgagaactacgtggccaagcgcatccctggcaagcaggctgttgtcgtgatggcctgtgagaaccagcacatgggggatgacatggtgcaagagccaggccttgtcatgatatttgcgcatggcgtggaagagatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Sp2 transcription factor - ELL associated factor 1 - UBX domain protein 10 - Bardet-Biedl syndrome 5 |