> >>PAQR4-progestin and adipoQ receptor family member IV Gene
PAQR4-progestin and adipoQ receptor family member IV Gene View larger

PAQR4-progestin and adipoQ receptor family member IV Gene

PTXBC033703

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of PAQR4-progestin and adipoQ receptor family member IV Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PAQR4-progestin and adipoQ receptor family member IV Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033703
Product type: DNA & cDNA
Ncbi symbol: PAQR4
Origin species: Human
Product name: PAQR4-progestin and adipoQ receptor family member IV Gene
Size: 2ug
Accessions: BC033703
Gene id: 124222
Gene description: progestin and adipoQ receptor family member IV
Synonyms: progestin and adipoQ receptor family member 4; progestin and adipoQ receptor family member IV
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgttcctggccgggccgcgcctgctggactgggccagctcgccgccgcacctgcagttcaataagttcgtgctgaccgggtaccggcccgccagcagcggctcgggctgcctgcgcagcctcttctacctgcacaacgaactgggcaacatctacacgcacgggctggccctgctgggcttcctggtgctggtgccaatgaccatgccctggggtcagctgggcaaggatggctggctgggaggcacacattgcgtggcctgccttgcaccccctgcaggctccgtgctctatcacctctttatgtgccaccaagggggcagcgctgtgtacgcccggctcctcgccctggacatgtgtggggtctgccttgtcaacacccttggggccctgcccatcatccactgcaccctggcctgcaggccctggctgcgcccggctgccctggtgggctacactgtgttgtcgggtgtggccggctggcgtgctctcaccgccccctccaccagtgctcggctccgggcatttggatggcaggctgctgcccgcctactggtatttggggcccggggagtgggtctgggttcaggggctccaggctccctgccctgctacctgcgcatggacgcactggcgctgcttgggggactggtaaatgtagcccgtctgcccgagcgctggggacctggccgctttgactactggggcaactcccaccagatcatgcacctgctgagcgtgggctccatcctgcagctgcacgccggcgtcgtgcccgacctgctctgggctgcccaccacgcctgtccccgggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neurotrophic tyrosine kinase, receptor, type 3
- cell division cycle 23 homolog (S. cerevisiae)
- DnaJ (Hsp40) homolog, subfamily C, member 16
- acyl-CoA synthetase long-chain family member 6

Reviews

Buy PAQR4-progestin and adipoQ receptor family member IV Gene now

Add to cart