Cart 11 Product Products 1 414,30 € (empty)
-
1 x TMEM100-tr...113,40 € -
1 x TMEM30B-tr...121,50 € -
1 x SFRS12IP1-...113,40 € -
1 x MIA-melano...113,40 € -
1 x DNAJC7-Dna...121,50 € -
1 x CORT-corti...113,40 € -
-
1 x RABL2B-RAB...113,40 € -
1 x PRSS23-pro...121,50 € -
1 x RPL3-ribos...113,40 € -
1 x LSM4-LSM4...113,40 €
No products
To be determined Shipping
1 414,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 414,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 414,30 €
View larger 
ASF1A-ASF1 anti-silencing function 1 homolog A (S. cerevisiae) Gene
PTXBC010878
New product
Data sheet of ASF1A-ASF1 anti-silencing function 1 homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASF1A-ASF1 anti-silencing function 1 homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010878 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASF1A |
| Origin species: | Human |
| Product name: | ASF1A-ASF1 anti-silencing function 1 homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC010878 |
| Gene id: | 25842 |
| Gene description: | ASF1 anti-silencing function 1 homolog A (S. cerevisiae) |
| Synonyms: | histone chaperone ASF1A; CGI-98; CIA; HSPC146; ASF1 anti-silencing function 1 homolog A; CCG1-interacting factor A; anti-silencing function protein 1 homolog A; hAsf1; hAsf1a; hCIA; anti-silencing function 1A histone chaperone |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaaggttcaggtgaacaatgtagtggtgctggataacccttctcctttctacaacccgttccagttcgagatcaccttcgagtgcatcgaggacctgtctgaagacttggaatggaaaattatctatgtgggctctgcagaaagtgaagaatacgatcaagttttagactctgttttagtgggtcctgttcccgcaggaaggcatatgtttgtatttcaggctgatgcacctaatccaggactcattccagatgcagatgcagtaggcgtaactgttgtgctaattacttgtacctatcgaggacaagaatttattagagttggctattatgtaaataatgaatatactgagacagaattaagggaaaatccaccagtaaaaccagacttttctaagcttcaaaggaatattttggcatctaatcccagggtcacaagattccacattaattgggaagataacacagaaaaactggaagatgcagagagcagtaatccaaatctacagtcacttctttcaacagatgcattaccttcagcatcaaagggatggtccacatcagaaaactcactaaatgtcatgttagaatcccacatggactgcatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tubulin polymerization-promoting protein family member 2 - transforming growth factor, beta receptor II (70/80kDa) - glutamate receptor, ionotropic, N-methyl D-aspartate 2C - coiled-coil-helix-coiled-coil-helix domain containing 2 |