Cart 9 Product Products 1 033,37 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
-
1 x NPTN-neuro...121,50 € -
1 x LIPA-lipas...121,50 € -
-
1 x PSMB10-pro...121,50 € -
-
No products
To be determined Shipping
1 033,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 033,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 033,37 €
Data sheet of TIMP1-TIMP metallopeptidase inhibitor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMP1-TIMP metallopeptidase inhibitor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007097 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMP1 |
| Origin species: | Human |
| Product name: | TIMP1-TIMP metallopeptidase inhibitor 1 Gene |
| Size: | 2ug |
| Accessions: | BC007097 |
| Gene id: | 7076 |
| Gene description: | TIMP metallopeptidase inhibitor 1 |
| Synonyms: | CLGI; EPA; EPO; HCI; TIMP; metalloproteinase inhibitor 1; collagenase inhibitor; erythroid potentiating activity; fibroblast collagenase inhibitor; tissue inhibitor of metalloproteinases 1; TIMP metallopeptidase inhibitor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccccctttgagcccctggcttctggcatcctgttgttgctgtggctgatagcccccagcagggcctgcacctgtgtcccaccccacccacagacggccttctgcaattccgacctcgtcatcagggccaagttcgtggggacaccagaagtcaaccagaccaccttataccagcgttatgagatcaagatgaccaagatgtataaagggttccaagccttaggggatgccgctgacatccggttcgtctacacccccgccatggagagtgtctgcggatacttccacaggtcccacaaccgcagcgaggagtttctcattgctggaaaactgcaggatggactcttgcacatcactacctgcagttttgtggctccctggaacagcctgagcttagctcagcgccggggcttcaccaagacctacactgttggctgtgaggaatgcacagtgtttccctgtttatccatcccctgcaaactgcagagtggcactcattgcttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Der1-like domain family, member 3 - RAB28, member RAS oncogene family - coiled-coil domain containing 60 - coiled-coil domain containing 67 |