Cart 22 Product Products 4 685,98 € (empty)
-
-
-
1 x hCG_181173...113,40 € -
1 x CCNI2-cycl...121,50 € -
1 x CCDC54-coi...121,50 € -
1 x HBD-hemogl...113,40 € -
1 x MKRN3-mako...113,40 € -
-
-
1 x UGCG-UDP-g...121,50 € -
1 x GEMIN7-gem...113,40 € -
1 x TMEM53-tra...121,50 € -
1 x HAT1-histo...121,50 € -
-
-
1 x C14orf100-...121,50 € -
1 x CCDC115-co...113,40 € -
1 x IL17F-inte...113,40 € -
-
-
1 x SERINC1-se...121,50 € -
1 x LDHA-lacta...121,50 €
No products
To be determined Shipping
4 685,98 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 685,98 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 685,98 €
View larger 
SLC13A4-solute carrier family 13 (sodium/sulfate symporters), member 4 Gene
PTXBC030689
New product
Data sheet of SLC13A4-solute carrier family 13 (sodium/sulfate symporters), member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC13A4-solute carrier family 13 (sodium/sulfate symporters), member 4 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC030689 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC13A4 |
| Origin species: | Human |
| Product name: | SLC13A4-solute carrier family 13 (sodium/sulfate symporters), member 4 Gene |
| Size: | 2ug |
| Accessions: | BC030689 |
| Gene id: | 26266 |
| Gene description: | solute carrier family 13 (sodium/sulfate symporters), member 4 |
| Synonyms: | NAS2; SUT-1; SUT1; solute carrier family 13 member 4; Na(+)/sulfate cotransporter SUT-1; solute carrier family 13 (sodium/sulfate symporter), member 4; solute carrier family 13 (sodium/sulfate symporters), member 4; solute carrier family 13 (sodium/sulphate symporters), member 4; sulphate transporter 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcctgctgcagggcctgctccgagtccggaagctgctgctggtcgtctgcgtcccgctcctgctgctgcctctgcccgtcctccaccccagcagcgaggcctcgtgtgcttacgtgctgatcgtgactgctgtgtactgggtgtcggaggcagtgcctctgggagctgcagccctggtgccggccttcctttacccgttcttcggagtcctccggtccaatgaggtggcggcggagtacttcaagaacaccacgctgctgctggtgggggtcatctgcgtggcggctgccgtggagaagtggaacctgcataagcgcattgctctgcgcatggtcttgatggccggagccaagccgggcatgctgctgctctgcttcatgtgctgtaccacgttgctgtccatgtggctgtccaacacctccaccaccgccatggtgatgcccatcgtggaggccgtgctgcaggagctggtcagtgctgaggacgagcagctcgtggcgggcaactccaacaccgaagaggccgaacccatcagtctggatgtaaagaacagccaaccttctctggaactcatctttgtcaatgaagagtccaacgcagacctcaccactctgatgcacaacgagaacctgaatggtgtgccctcgatcaccaaccccatcaaaactgcaaaccaacaccagggcaagaagcaacacccatcccaggaaaagccacaagtcctgacccgcagccccaggaagcagaagctgaacagaaagtacaggtcccaccatgaccagatgatctgcaagtgcctctccctgagcatatcctactccgctaccattggcggcctgaccaccatcatcggcacctccaccagcctcatcttcctggaacacttcaacaaccagtatccagccgcagaggtggtgaactttggcacctggttcctcttcagcttccccatatccctcatcatgctggtggtcagctggttctggatgcactggctgttcctgggctgcaattttaaagagacctgctctctgagcaagaagaagaagaccaaaagggaacagttgtcagagaagaggatccaagaagaatatgaaaaactgggagacattagctacccagaaatggtgactggatttttcttcatcctgatgaccgtactgtggtttacccgggagcctggctttgtccctggctgggattctttctttgaaaagaaaggctaccgtactgatgccacagtctctgtcttccttggcttcctcctcttcctcattccagcgaagaagccctgctttgggaaaaagaatgatggagagaaccaggagcactcactggggaccgagcccatcatcacgtggaaggacttccagaagaccatgccctgggagattgtcattctggttgggggaggctatgctctggcttctggtagcaagagctctggcctctctacatggattgggaaccagatgttgtccctgagcagcctcccaccgtgggctgtcaccctgctggcatgcatcctcgtgtccattgtcactgagtttgtgagcaacccagcaaccatcaccatcttcctgcccatcctgtgcagcctgtctgaaacgctgcacattaaccccctctacaccctgatcccagtcaccatgtgcatctcctttgcagtgatgctgcctgtgggcaatccccctaatgccatcgtcttcagctatgggcactgccagatcaaagatatggtgaaagctggcctgggagtcaacgttattggactggtgatagtaatggtggccatcaacacctggggagttagcctcttccacctggacacttacccagcatgggcgagggtcagcaacatcactgatcaagcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine rich repeat and fibronectin type III domain containing 5 - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 - DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) - solute carrier family 22 (organic anion transporter), member 7 |