Cart 5 Product Products 1 514,75 € (empty)
-
-
1 x ANKHD1-ank...121,50 € -
1 x ABI2-abl...121,50 € -
-
No products
To be determined Shipping
1 514,75 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 514,75 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 514,75 €
View larger 
HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene
PTXBC001236
New product
Data sheet of HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001236 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HSPBP1 |
| Origin species: | Human |
| Product name: | HSPBP1-HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Gene |
| Size: | 2ug |
| Accessions: | BC001236 |
| Gene id: | 23640 |
| Gene description: | HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 |
| Synonyms: | FES1; hsp70-binding protein 1; HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1; heat shock protein-binding protein 1; hsp70 interacting protein; HSPA (Hsp70) binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagacgaaggctcaagggggagccgcctgcccctggcgctgcccccggcctcccagggttgctcttcagggggcggcggcggcggcggcggcggctcctcggctgggggctcgggcaattcccggcccccacgcaacctccaaggcttgctgcagatggccatcaccgcgggctctgaagagccagaccctcctccagaaccgatgagtgaggagaggcgtcagtggctgcaggaggccatgtcggctgccttccgaggccagcgggaggaggtggagcagatgaagagctgcctccgagtgctgtcacagcccatgccccccactgctggggaggccgagcaggcggccgaccagcaagagcgagagggggccctggagctgctggccgacctgtgtgagaacatggacaatgccgcagacttctgccagctgtctggcatgcacctgctggtgggccggtacctggaggcgggggctgcgggactgcggtggcgggcggcacagctcatcggcacgtgcagtcagaacgtggcagccatccaggagcaggtgctgggcctgggtgccctgcgtaagctgctgcggctgctggaccgcgacgcctgcgacacggtgcgcgtcaaggccctcttcgccatctcctgtctggtccgagagcaggaggctgggctgctgcagttcctccgcctggacggcttctctgtgttgatgagggccatgcagcagcaggtgcagaagctcaaggtcaaatcagcattcctgctgcagaacctgctggtgggccaccctgaacacaaagggaccctgtgctccatggggatggtccagcagctggtggccctggtgcggacagagcacagccccttccacgagcacgtgcttggagccctgtgcagcctggtgacagactttccgcagggtgtgcgcgagtgtcgggagccggaactgggcctggaggagctcctccgccaccgctgtcagctgctgcagcagcatgaggagtaccaggaggagctggagttctgtgaaaagctgctacagacctgtttctccagcccagcggacgacagcatggatcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 5 (sodium/glucose cotransporter), member 10 - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 - BTB and CNC homology 1, basic leucine zipper transcription factor 1 - solute carrier family 5 (sodium/glucose cotransporter), member 11 |