Cart 2 Product Products 243,00 € (empty)
-
1 x LYAR-Ly1...121,50 € -
1 x UBXN2B-UBX...121,50 €
No products
To be determined Shipping
243,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 243,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 243,00 €
View larger 
Data sheet of SCAMP3-secretory carrier membrane protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCAMP3-secretory carrier membrane protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000161 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCAMP3 |
| Origin species: | Human |
| Product name: | SCAMP3-secretory carrier membrane protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC000161 |
| Gene id: | 10067 |
| Gene description: | secretory carrier membrane protein 3 |
| Synonyms: | C1orf3; secretory carrier-associated membrane protein 3; propin 1; secretory carrier membrane protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcagagcagagacggcggaaacccgttcgccgagcccagcgagcttgacaacccctttcaggacccagctgtgatccagcaccgacccagccggcagtatgccacgcttgacgtctacaacccttttgagacccgggagccaccaccagcctatgagcctccagcccctgccccattgcctccaccctcagctccctccttgcagccctcgagaaagctcagccccacagaacctaagaactatggctcatacagcactcaggcctcagctgcagcagccacagctgagctgctgaagaaacaggaggagctcaaccggaaggcagaggagttggaccgaagggagcgagagctgcagcatgctgccctggggggcacagctactcgacagaacaattggccccctctaccttctttttgtccagttcagccctgctttttccaggacatctccatggagatcccccaagaatttcagaagactgtatccaccatgtactacctctggatgtgcagcacgctggctcttctcctgaacttcctcgcctgcctggccagcttctgtgtggaaaccaacaatggcgcaggctttgggctttctatcctctgggtcctccttttcactccctgctcctttgtctgctggtaccgccccatgtataaggctttccggagtgacagttcattcaatttcttcgttttcttcttcattttcttcgtccaggatgtgctctttgtcctccaggccattggtatcccaggttggggattcagtggctggatctctgctctggtggtgccgaagggcaacacagcagtatccgtgctcatgctgctggtcgccctgctcttcactggcattgctgtgctaggaattgtcatgctgaaacggatccactccttataccgccgcacaggtgccagctttcagaaggcccagcaagaatttgctgctggtgtcttctccaaccctgcggtgcgaaccgcagctgccaatgcagccgctggggctgctgaaaatgccttccgggccccgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PML-RARA regulated adaptor molecule 1 - Fas-activated serine/threonine kinase - heat shock 70kDa protein 9 (mortalin) - small G protein signaling modulator 3 |