Cart 27 Product Products 3 377,79 € (empty)
-
1 x RPP40-ribo...113,40 € -
1 x ZNF672-zin...113,40 € -
1 x NAGS-N-ace...121,50 € -
1 x FBXL15-F-b...121,50 € -
1 x MFAP4-micr...113,40 € -
1 x C21orf88-c...113,40 € -
1 x GPBP1L1-GC...121,50 € -
1 x SF3B14-spl...113,40 € -
1 x Rho A...259,07 € -
1 x LOC57228-s...113,40 € -
1 x UBAC2-UBA...113,40 € -
1 x PKNOX1-PBX...121,50 € -
1 x EDARADD-ED...113,40 € -
1 x FAM3D-fami...113,40 € -
1 x MTTP-micro...113,40 € -
-
1 x C10orf65-c...113,40 € -
1 x C10orf114-...113,40 € -
1 x DPY19L2P1-...113,40 € -
-
1 x GSTM3-glut...113,40 € -
1 x FAM64A-fam...113,40 € -
1 x STAC3-SH3...121,50 € -
-
1 x SLC25A39-s...121,50 € -
-
1 x CSRP3-cyst...113,40 €
No products
To be determined Shipping
3 377,79 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 27 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 377,79 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 377,79 €
Data sheet of CKM-creatine kinase, muscle Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CKM-creatine kinase, muscle Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007462 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CKM |
| Origin species: | Human |
| Product name: | CKM-creatine kinase, muscle Gene |
| Size: | 2ug |
| Accessions: | BC007462 |
| Gene id: | 1158 |
| Gene description: | creatine kinase, muscle |
| Synonyms: | CKMM; M-CK; creatine kinase M-type; creatine kinase M chain; creatine kinase, muscle; creatine kinase, M-type |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccattcggtaacacccacaacaagttcaagctgaattacaagcctgaggaggagtaccccgacctcagcaaacataacaaccacatggccaaggtactgacccttgaactctacaagaagctgcgggacaaggagactccatctggcttcactgtagacgatgtcatccagacaggagtggacaacccaggtcaccccttcatcatgaccgtgggctgcgtggctggtgatgaggagtcctacgaagttttcaaggaactctttgaccccatcatctcggatcgccacgggggctacaaacccactgacaagcacaagactgacctcaaccatgaaaacctcaagggtggagacgacctggaccccaactacgtgctcagcagccgcgtccgcactggccgcagcatcaagggctacacgttgcccccacactgctcccgtggcgagcgccgggcggtggagaagctctctgtggaagctctcaacagcctgacgggcgagttcaaagggaagtactaccctctgaagagcatgacggagaaggagcagcagcagctcatcgatgaccacttcctgttcgacaagcccgtgtccccgctgctgctggcctcaggcatggcccgcgactggcccgacgcccgtggcatctggcacaatgacaacaagagcctcctggtgtgggtgaacgaggaggatcacctccgggtcatctccatggagaaggggggcaacatgaaggaggttttccgccgcttctgcgtagggctgcagaagattgaggagatctttaagaaagctggccaccccttcatgtggaaccagcacctgggctacgtgctcacctgcccatccaacctgggcactgggctgcgtggaggcgtgcatgtgaagctggcgcacctgagcaagcaccccaagttcgaggagatcctcacccgcctgcgtctgcagaagaggggtacaggtggcgtggacacagctgccgtgggctcagtatttgacgtgtccaacgctgatcggctgggctcgtccgaagtagaacaggtgcagctggtggtggatggtgtgaagctcatggtggaaatggagaagaagttggagaaaggccagtccatcgacgacatgatccccgcccagaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - silver homolog (mouse) - ribosomal protein L30 - embigin homolog (mouse) - H3 histone, family 3A |