Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPINB1-serpin peptidase inhibitor, clade B (ovalbumin), member 1 Gene
PTXBC009015
New product
Data sheet of SERPINB1-serpin peptidase inhibitor, clade B (ovalbumin), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINB1-serpin peptidase inhibitor, clade B (ovalbumin), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009015 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINB1 |
| Origin species: | Human |
| Product name: | SERPINB1-serpin peptidase inhibitor, clade B (ovalbumin), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC009015 |
| Gene id: | 1992 |
| Gene description: | serpin peptidase inhibitor, clade B (ovalbumin), member 1 |
| Synonyms: | ELANH2; HEL-S-27; HEL57; LEI; M/NEI; MNEI; PI-2; PI2; leukocyte elastase inhibitor; epididymis luminal protein 57; epididymis secretory protein Li 27; peptidase inhibitor 2; protease inhibitor 2 (anti-elastase), monocyte/neutrophil derived; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1; serpin peptidase inhibitor, clade B (ovalbumin), member 1; serpin family B member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcagctgagctcagcaaacacccgcttcgccttggacctgttcctggcgttgagtgagaacaatccggctggaaacatcttcatctctcccttcagcatttcatctgctatggccatggtttttctggggaccagaggtaacacggcagcacagctgtccaagactttccatttcaacacggttgaagaggttcattcaagattccagagtctgaatgctgatatcaacaaacgtggagcgtcttatattctgaaacttgctaatagattatatggagagaaaacttacaatttccttcctgagttcttggtttcgactcagaaaacatatggtgctgacctggccagtgtggattttcagcatgcctctgaagatgcaaggaagaccataaaccagtgggtcaaaggacagacagaaggaaaaattccggaactgttggcttcgggcatggttgataacatgaccaaacttgtgctagtaaatgccatctatttcaagggaaactggaaggataaattcatgaaagaagccacgacgaatgcaccattcagattgaataagaaagacagaaaaactgtgaaaatgatgtatcagaagaaaaaatttgcatatggctacatcgaggaccttaagtgccgtgtgctggaactgccttaccaaggcgaggagctcagcatggtcatcctgctgccggatgacattgaggacgagtccacgggcctgaagaagattgaggaacagttgactttggaaaagttgcatgagtggactaaacctgagaatctcgatttcattgaagttaatgtcagcttgcccaggttcaaactggaagagagttacactctcaactccgacctcgcccgcctaggtgtgcaggatctctttaacagtagcaaggctgatctgtctggcatgtcaggagccagagatatttttatatcaaaaattgtccacaagtcatttgtggaagtgaatgaagagggaacagaggcggcagctgccacagcaggcatcgcaactttctgcatgttgatgcccgaagaaaatttcactgccgaccatccattccttttctttattcggcataattcctcaggtagcatcctattcttggggagattttcttccccttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - synovial sarcoma translocation gene on chromosome 18-like 1 - protein phosphatase 1, regulatory (inhibitor) subunit 12C - guanine nucleotide binding protein (G protein), q polypeptide - XK, Kell blood group complex subunit-related family, member 3 |