Cart 16 Product Products 2 279,34 € (empty)
-
1 x RAB6A-RAB6...113,40 € -
1 x HDHD2-halo...113,40 € -
1 x IDI1-isope...113,40 € -
-
1 x AASDHPPT-a...121,50 € -
1 x OCM-oncomo...113,40 € -
1 x IFNA21-int...113,40 € -
1 x IFNB1-inte...113,40 € -
1 x ABHD14A...259,07 € -
-
1 x DDIT4L-DNA...113,40 € -
1 x APLN-apeli...113,40 € -
1 x UBE2V1-ubi...113,40 € -
-
1 x ST3GAL3-ST...121,50 € -
No products
To be determined Shipping
2 279,34 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 16 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 279,34 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 279,34 €
View larger 
Data sheet of WIPF1-WAS/WASL interacting protein family, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about WIPF1-WAS/WASL interacting protein family, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002914 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WIPF1 |
| Origin species: | Human |
| Product name: | WIPF1-WAS/WASL interacting protein family, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC002914 |
| Gene id: | 7456 |
| Gene description: | WAS/WASL interacting protein family, member 1 |
| Synonyms: | PRPL-2; WAS2; WASPIP; WAS/WASL-interacting protein family member 1; WASP-interacting protein; Wiskott-Aldrich syndrome protein interacting protein; protein PRPL-2; testicular tissue protein Li 226; WAS/WASL interacting protein family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgtccctccccctccagcacccccgccgcccccgacgtttgcactggccaatacagagaagcctaccttgaataagacagagcaggctgggagaaatgctctcctttctgatatcagcaaagggaagaaactaaagaagacggtcaccaatgacagaagtgcaccaatactggacaaacctaaaggagctggtgctggaggcggtggtggtggctttggtggaggcggcggatttggcggaggaggtggtggcggaggcggtggaagttttggagggggcggacctccaggtctgggaggattgttccaggctggaatgccgaagctgagatccacggccaacagggataatcattctggaggaagccgaccaccattgttgccaccgggaggaagatccacatctgcgaaacccttttcacccccaagtggcccagggaggtttcctgtgccttctccaggccacagaagtggtcccccagagcctcagaggaaccgaatgccgcccccaaggcccgacgtgggctcaaagcctgatagcattcctcctccagtacctagtactccaagacccattcaatcaagtctgcacaaccgggggtccccaccagtgcccggaggccccaggcagcccagccccgggcccactcctcccccacctccagtgagggacccgccaggccgatcaggccccctcccaccacctcctccagtaagcagaaacggcagcacatctcgggccctgcctgctacccctcagttgccatccaggagtggagtagacagtcccaggagtggacccaggcctccccttcctcctgataggcccagtgctggggcacctcccccacctccaccatcaacatctattagaaatggcttccaagactctccatgtgaagatgagtgggaaagcagattctacttccatccgatttccgatttgccacctccagagccatatgtacaaacgaccaaaagttatcccagcaaactggcaagaaacgaaagccggagtggatccaaccgaagagaaaggggtgctccaccactccctcccatcccgaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain interacting protein - dynein, cytoplasmic 1, intermediate chain 2 - family with sequence similarity 65, member B - family with sequence similarity 26, member D |