PTXBC007980
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC007980 |
Product type: | DNA & cDNA |
Ncbi symbol: | TMBIM1 |
Origin species: | Human |
Product name: | TMBIM1-transmembrane BAX inhibitor motif containing 1 Gene |
Size: | 2ug |
Accessions: | BC007980 |
Gene id: | 64114 |
Gene description: | transmembrane BAX inhibitor motif containing 1 |
Synonyms: | LFG3; MST100; MSTP100; PP1201; RECS1; protein lifeguard 3; transmembrane BAX inhibitor motif-containing protein 1; transmembrane BAX inhibitor motif containing 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtccaaccccagcgccccaccaccatatgaagaccgcaaccccctgtacccaggccctctgccccctgggggctatgggcagccatctgtcctgccaggagggtatcctgcctaccctggctacccgcagcctggctacggtcaccctgctggctacccacagcccatgccccccacccacccgatgcccatgaactacggcccaggccatggctatgatggggaggagagagcggtgagtgatagcttcgggcctggagagtgggatgaccggaaagtgcgacacacttttatccgaaaggtttactccatcatctccgtgcagctgctcatcactgtggccatcattgctatcttcacctttgtggaacctgtcagcgcctttgtgaggagaaatgtggctgtctactacgtgtcctatgctgtcttcgttgtcacctacctgatccttgcctgctgccagggacccagacgccgtttcccatggaacatcattctgctgaccctttttacttttgccatgggcttcatgacgggcaccatttccagtatgtaccaaaccaaagccgtcatcattgcaatgatcatcactgcggtggtatccatttcagtcaccatcttctgctttcagaccaaggtggacttcacctcgtgcacaggcctcttctgtgtcctgggaattgtgctcctggtgactgggattgtcactagcattgtgctctacttccaatacgtttactggctccacatgctctatgctgctctgggggccatttgtttcaccctgttcctggcttacgacacacagctggtcctggggaaccggaagcacaccatcagccccgaggactacatcactggcgccctgcagatttacacagacatcatctacatcttcacctttgtgctgcagctgatgggggatcgcaattaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - EGF-like repeats and discoidin I-like domains 3 - katanin p80 (WD repeat containing) subunit B 1 - EP300 interacting inhibitor of differentiation 1 - nuclear receptor subfamily 4, group A, member 1 |