Cart 12 Product Products 1 704,08 € (empty)
-
-
1 x MGC9913-hy...113,40 € -
1 x DDOST-doli...121,50 € -
1 x GPR82-G...121,50 € -
1 x LOC440905-...113,40 € -
1 x MGC16075-h...113,40 € -
1 x FGFBP1-fib...113,40 € -
1 x CREB3L2-cA...113,40 € -
1 x SNAPC5-sma...113,40 € -
1 x CERK-ceram...113,40 € -
1 x VPS24-vacu...113,40 € -
1 x DMC1-DMC1...121,50 €
No products
To be determined Shipping
1 704,08 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 704,08 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 704,08 €
View larger 
Data sheet of HRASLS5-HRAS-like suppressor family, member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HRASLS5-HRAS-like suppressor family, member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034222 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HRASLS5 |
| Origin species: | Human |
| Product name: | HRASLS5-HRAS-like suppressor family, member 5 Gene |
| Size: | 2ug |
| Accessions: | BC034222 |
| Gene id: | 117245 |
| Gene description: | HRAS-like suppressor family, member 5 |
| Synonyms: | HRLP5; HRSL5; RLP1; iNAT; Ca(2+)-independent N-acyltransferase; H-rev107-like protein 5; HRAS-like suppressor 5; calcium-independent phosphatidylethanolamine N-acyltransferase; lecithin-retinol acyltransferase (LRAT)-like protein-1; testicular tissue protein Li 90; HRAS like suppressor family member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcctgagcccgggcgccgagggggagtacgcgctccgcctccctaggattcccccacccctccccaaacccgcctcgcgaaccgccggtaccgggcccaaggaccagccgcctgcgctcagacgttcagctgtgccccactcagaagaatccgtgggattcgcagcgttggtccagctcccagccaagcagcctccgccgggcacattagaacagggcagaagcatccagcaaggggagaaggctgtagttagcttggagaccacacccagccagaaagcagactggagttcaattccaaagcctgagaatgaaggcaagttaataaagcaagcagctgagggaaaaccaagacccagacctggagacctgattgagatttttcgaattggctatgagcactgggccatctatgtagaagatgattgcgtggtccatctggctcccccaagtgaggagtttgaggtgggcagcattacttccatctttagcaatcgggccgtggtgaaatacagtcgtctggaggatgtgctgcatggctgctcctggaaggtcaataacaagctagatgggacgtacctgcccttgccggtggacaagatcatccagcgtacaaaaaagatggtcaacaagatcgtgcagtacagcctgattgaagggaactgtgagcactttgtcaatggcctcagatatggcgtaccccggagccagcaggtagagcacgccctgatggaaggagcgaaggctgctggagcagttatttcagctgtagtggatagcataaagcccaaaccaataactgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - D4, zinc and double PHD fingers family 2 - lysosomal-associated membrane protein 1 - isocitrate dehydrogenase 3 (NAD+) gamma - transmembrane and coiled-coil domains 3 |