PTXBC025744
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC025744 |
Product type: | DNA & cDNA |
Ncbi symbol: | LRRC25 |
Origin species: | Human |
Product name: | LRRC25-leucine rich repeat containing 25 Gene |
Size: | 2ug |
Accessions: | BC025744 |
Gene id: | 126364 |
Gene description: | leucine rich repeat containing 25 |
Synonyms: | MAPA; leucine-rich repeat-containing protein 25; monocyte and plasmacytoid activated molecule; monocyte and plasmacytoid-activated protein; leucine rich repeat containing 25 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggggcgctggccgcccgctgtgaccttgacctgcaggccgactgcaactgtgccctggagtcctggcacgacatccgccgagacaactgctctggccagaagcctctgctctgctgggacacaaccagctcccagcacaacctctctgccttcctggaggtcagctgcgcccctggcctggcctctgcaactatcggggcagtggtggtcagcgggtgcctgcttcttggacttgccatcgctggccctgtgctggcctggagactctggcgatgccgagtggccagaagccgggagctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - THO complex 6 homolog (Drosophila) - leucine rich repeat containing 56 - interleukin 13 receptor, alpha 1 - sphingosine-1-phosphate receptor 4 |