Cart 9 Product Products 1 033,37 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
-
1 x NPTN-neuro...121,50 € -
1 x LIPA-lipas...121,50 € -
-
1 x PSMB10-pro...121,50 € -
-
No products
To be determined Shipping
1 033,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 033,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 033,37 €
View larger 
Data sheet of SLC35B1-solute carrier family 35, member B1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC35B1-solute carrier family 35, member B1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011888 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC35B1 |
| Origin species: | Human |
| Product name: | SLC35B1-solute carrier family 35, member B1 Gene |
| Size: | 2ug |
| Accessions: | BC011888 |
| Gene id: | 10237 |
| Gene description: | solute carrier family 35, member B1 |
| Synonyms: | UGTREL1; solute carrier family 35 member B1; UDP-galactose transporter related; UDP-galactose transporter-related protein 1; hUGTrel1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctctagcagctccctggtgcccgaccggctgcgcctgccgctctgcttcctgggtgtctttgtctgctatttttactatgggatcctgcaggaaaagataacaagaggaaagtatggggaaggagccaagcaggagacgttcacctttgccttaactttggtcttcattcaatgtgtgatcaatgctgtgtttgccaagatcttgatccagttttttgacactgccagggtggatcatacccggagctggctctatgctgcctgttctatctcctatctgggtgccatggtctccagcaattcagcactacagtttgtcaactacccaactcaggtccttggtaaatcctgcaagccaatcccagtcatgctccttggggtgaccctcttgaagaagaagtacccgttggccaagtacctgtgtgtgctgttaattgtggctggagtggcccttttcatgtacaaacccaagaaagttgttgggatagaagaacacacagtcggctatggagagctactcttgctattatcgctgaccctggatggactgactggtgtttcccaggaccacatgcgggctcattaccaaacaggctccaaccacatgatgctgaacatcaacctttggtcgacattgctgctgggaatgggaatcctgttcactggggagctctgggagttcttgagctttgctgaaaggtaccctgccatcatctataacatcctgctctttgggctgaccagtgccctgggtcagagcttcatctttatgacggttgtgtattttggtcccctgacctgctccatcatcactacaactcgaaagttcttcacaattttggcctctgtgatcctcttcgccaatcccatcagccccatgcagtgggtgggcactgtgcttgtgttcctgggtcttggtcttgatgccaagtttgggaaaggagctaagaagacatcccactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - secretory carrier membrane protein 3 - PML-RARA regulated adaptor molecule 1 - Fas-activated serine/threonine kinase - heat shock 70kDa protein 9 (mortalin) |