Cart 45 Product Products 5 700,29 € (empty)
-
1 x DLX3-dista...121,50 € -
1 x KIAA0895L-...121,50 € -
1 x C1D-nuclea...113,40 € -
1 x MLF1IP-MLF...121,50 € -
1 x RPL36AL-ri...113,40 € -
1 x SLC7A6OS-s...121,50 € -
1 x CHST6...259,07 € -
1 x LEP-leptin...113,40 € -
1 x TECTB-tect...121,50 € -
1 x GAL3ST3-ga...121,50 € -
-
1 x MYCL1-v-my...113,40 € -
1 x TMEM18-tra...113,40 € -
-
1 x HOXC11-hom...121,50 € -
1 x KRTAP3-3-k...113,40 € -
1 x TRGV3-T...113,40 € -
1 x FLJ41649-h...113,40 € -
-
1 x HNT-neurot...121,50 € -
1 x CARKD-carb...121,50 € -
1 x RASSF6-Ras...121,50 € -
1 x NKAP-NFKB...121,50 € -
-
1 x SLC43A3-so...121,50 € -
1 x TWF1-twinf...113,40 € -
1 x SLAMF1-sig...113,40 € -
1 x DNAJA4-Dna...121,50 € -
1 x RPL18A-rib...113,40 € -
-
-
1 x PPY-pancre...113,40 € -
1 x SOD2-super...113,40 € -
1 x MDFI-MyoD...113,40 € -
1 x TNFRSF6B-t...121,50 € -
1 x SCCPDH-sac...121,50 € -
1 x IL24-inter...113,40 € -
1 x NR1H3-nucl...121,50 € -
1 x RAD51AP1-R...121,50 € -
1 x KCNN3-pota...121,50 € -
-
-
1 x FLYWCH2-FL...113,40 € -
1 x PRKAG3-pro...121,50 € -
No products
To be determined Shipping
5 700,29 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 45 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 700,29 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 700,29 €
View larger 
Data sheet of MTCH1-mitochondrial carrier homolog 1 (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MTCH1-mitochondrial carrier homolog 1 (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000702 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MTCH1 |
| Origin species: | Human |
| Product name: | MTCH1-mitochondrial carrier homolog 1 (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC000702 |
| Gene id: | 23787 |
| Gene description: | mitochondrial carrier homolog 1 (C. elegans) |
| Synonyms: | CGI-64; PIG60; PSAP; SLC25A49; mitochondrial carrier homolog 1; cell proliferation-inducing protein 60; presenilin-associated protein; solute carrier family 25, member 49; mitochondrial carrier 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatggcgggtcagggggcctggggtctggggacaacgccccgaccactgaggctcttttcgtggcactgggcgcgggcgtgacggcgctcagccatcccctgctctacgtgaagctgctcatccaggtgggtcatgagccgatgccccccacccttgggaccaatgtgctggggaggaaggtcctctatctgccgagcttcttcacctacgccaagtacatcgtgcaagtggatggtaagatagggctgttccgaggcctgagtccccggctgatgtccaacgccctctctactgtgactcggggtagcatgaagaaggttttccctccagatgagattgagcaggtttccaacaaggatgatatgaagacttccctgaagaaagttgtgaaggagacctcctacgagatgatgatgcagtgtgtgtcccgcatgttggcccaccccctgcatgtcatctcaatgcgctgcatggtccagtttgtgggacgggaggccaagtacagtggtgtgctgagctccattgggaagattttcaaagaggaagggctgctgggattcttcgttggattaatccctcacctcctgggcgatgtggttttcttgtggggctgtaacctgctggcccacttcatcaatgcctacctggtggatgacagcttcagccaggccctggccatccggagctataccaagttcgtgatggggattgcagtgagcatgctgacctaccccttcctgctagttggcgacctcatggctgtgaacaactgcgggctgcaagctgggctccccccttactccccagtgttcaaatcctggattcactgctggaagtacctgagtgtgcagggccagctcttccgaggctccagcctgcttttccgccgggtgtcatcaggatcatgctttgccctggagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class I, F - DnaJ (Hsp40) homolog, subfamily C, member 4 - preferentially expressed antigen in melanoma - mitochondrial carrier homolog 1 (C. elegans) |