Cart 13 Product Products 1 498,75 € (empty)
-
1 x PSMC2-prot...121,50 € -
1 x NUDT2-nudi...113,40 € -
1 x LMAN2L-lec...121,50 € -
1 x C7orf49-ch...113,40 € -
1 x GLO1-glyox...113,40 € -
1 x DUT-deoxyu...113,40 € -
1 x C1orf123-c...113,40 € -
1 x CD200R1-CD...121,50 € -
1 x IMP3-IMP3,...113,40 € -
1 x COG3-compo...121,50 € -
-
-
1 x LIN28-lin-...113,40 €
No products
To be determined Shipping
1 498,75 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 498,75 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 498,75 €
Data sheet of TMEM38B-transmembrane protein 38B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM38B-transmembrane protein 38B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000049 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM38B |
| Origin species: | Human |
| Product name: | TMEM38B-transmembrane protein 38B Gene |
| Size: | 2ug |
| Accessions: | BC000049 |
| Gene id: | 55151 |
| Gene description: | transmembrane protein 38B |
| Synonyms: | C9orf87; D4Ertd89e; OI14; TRIC-B; TRICB; bA219P18.1; trimeric intracellular cation channel type B; transmembrane protein 38B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggattctccatgggacgagttggctctggccttctcccgcacgtccatgtttcccttttttgacatcgcgcactatctagtgtcagtgatggcggtgaaacgtcagccgggagcagctgcattggcatggaagaatcctatttcaagctggtttactgctatgctccactgttttggtggaggaattttatcctgtctactgcttgcagagcctccattgaagtttcttgcaaaccacactaacatattactggcatcttcaatctggtatattacatttttttgcccgcatgacctagtttcccagggctattcatatctacctgttcaactactggcttcgggaatgaaggaagtgaccagaacttggaaaatagtaggtggagtcacacatgctaatagctattacaaaaatggctggatagtcatgatagctattggatgggcccgaggtgcaggtggtaccattataacgaattttgagaggttggtaaaaggagattggaaaccagaaggtgatgaatggctgaagatgtcataccctgccaaggtaaccctgctggggtcagttatcttcacattccagcacacccagcatctggcaatatcaaagcataatcttatgttcctttataccatctttattgtggccacaaagataaccatgatgactacacagacttctactatgacatttgctccttttgaggatacattgagttggatgctatttggctggcagcagccgttttcatcatgtgagaagaaaagtgaagcaaagtcaccttccaatggcgttgggtcattggcctcaaagccggtagatgttgcctcagataatgttaaaaagaaacatactaagaagaatgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - collagen, type II, alpha 1 - transmembrane protein 171 - exostoses (multiple)-like 2 - prostaglandin E synthase 2 |