Cart 2 Product Products 230,97 € (empty)
-
1 x TECTB-tect...121,50 € -
No products
To be determined Shipping
230,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 230,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 230,97 €
View larger 
Data sheet of BCAT1-branched chain aminotransferase 1, cytosolic Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BCAT1-branched chain aminotransferase 1, cytosolic Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033864 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BCAT1 |
| Origin species: | Human |
| Product name: | BCAT1-branched chain aminotransferase 1, cytosolic Gene |
| Size: | 2ug |
| Accessions: | BC033864 |
| Gene id: | 586 |
| Gene description: | branched chain aminotransferase 1, cytosolic |
| Synonyms: | BCATC; BCT1; ECA39; MECA39; PNAS121; PP18; branched-chain-amino-acid aminotransferase, cytosolic; branched chain amino-acid transaminase 1, cytosolic; branched chain aminotransferase 1, cytosolic; placental protein 18; branched chain amino acid transaminase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggattgcagtaacggatgctccgcagagtgtaccggagaaggaggatcaaaagaggtggtggggacttttaaggctaaagacctaatagtcacaccagctaccattttaaaggaaaaaccagaccccaataatctggtttttggaactgtgttcacggatcatatgctgacggtggagtggtcctcagagtttggatgggagaaacctcatatcaagcctcttcagaacctgtcattgcaccctggctcatcagctttgcactatgcagtggaattatttgaaggattgaaggcatttcgaggagtagataataaaattcgactgtttcagccaaacctcaacatggatagaatgtatcgctctgctgtgagggcaactctgccggtatttgacaaagaagagctcttagagtgtattcaacagcttgtgaaattggatcaagaatgggtcccatattcaacatctgctagtctgtatattcgtcctacattcattggaactgagccttctcttggagtcaagaagcctaccaaagccctgctctttgtactcttgagcccagtgggaccttatttttcaagtggaacctttaatccagtgtccctgtgggccaatcccaagtatgtaagagcctggaaaggtggaactggggactgcaagatgggagggaattacggctcatctctttttgcccaatgtgaagcagtagataatgggtgtcagcaggtcctgtggctctatggagaggaccatcagatcactgaagtgggaactatgaatctttttctttactggataaatgaagatggagaagaagaactggcaactcctccactagatggcatcattcttccaggagtgacaaggcggtgcattctggacctggcacatcagtgggacacagaactcagcttgttttcaattaatttgcctgattttctgcagttcatttacttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial carrier homolog 1 (C. elegans) - major histocompatibility complex, class I, F - DnaJ (Hsp40) homolog, subfamily C, member 4 - preferentially expressed antigen in melanoma |