Cart 21 Product Products 2 480,33 € (empty)
-
1 x BMF-Bcl2...113,40 € -
1 x TSEN15-tRN...113,40 € -
1 x METTL10-me...113,40 € -
1 x FAIM-Fas...113,40 € -
1 x KCNE1L-KCN...113,40 € -
1 x EPM2A-epil...113,40 € -
1 x CCDC104-co...121,50 € -
-
1 x YWHAB-tyro...113,40 € -
1 x FKBP4-FK50...121,50 € -
1 x CASP5-casp...121,50 € -
1 x ACTR8-ARP8...121,50 € -
1 x TCTN3-tect...121,50 € -
1 x MKS1-Mecke...121,50 € -
-
1 x RPL3-ribos...121,50 € -
1 x ART3-ADP-r...121,50 € -
1 x TSSC4-tumo...113,40 € -
-
-
1 x CRYAA-crys...113,40 €
No products
To be determined Shipping
2 480,33 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 480,33 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 480,33 €
Data sheet of PIR-pirin (iron-binding nuclear protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PIR-pirin (iron-binding nuclear protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002517 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PIR |
| Origin species: | Human |
| Product name: | PIR-pirin (iron-binding nuclear protein) Gene |
| Size: | 2ug |
| Accessions: | BC002517 |
| Gene id: | 8544 |
| Gene description: | pirin (iron-binding nuclear protein) |
| Synonyms: | pirin (iron-binding nuclear protein) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggtcctccaagaaagttactctctcagtgctcagccgggagcagtcggaaggggttggagcgagggtccggagaagcattggcagacccgagttaaaaaatctggatccgtttttactgtttgatgaatttaaaggaggtagaccaggaggatttcctgatcatccacatcgaggttttgaaacagtatcctacctcctggaagggggcagcatggcccatgaagacttctgtggacacactggtaaaatgaacccaggagatttgcagtggatgactgcgggccggggcattctgcacgctgagatgccttgctcagaggagccagcccatggcctacaactgtgggttaatttgaggagctcagagaagatggtggagcctcagtaccaggaactgaaaagtgaagaaatccctaaacccagtaaggatggtgtgacagttgctgtcatttctggagaagccctgggaataaagtccaaggtttacactcgcacaccaaccttatatttggacttcaaattggacccaggagccaaacattcccaacctatccctaaagggtggacaagcttcatttacacgatatctggagatgtgtatattgggcccgatgatgcacaacaaaaaatagaacctcatcacacagcagtgcttggagaaggtgacagtgtccaggtggagaacaaggatcccaagagaagccactttgtcttaattgctggggagccattaagagaaccagttatccaacatggtccatttgtgatgaacaccaatgaagagatttctcaagctattcttgatttcagaaacgcaaaaaatgggtttgaaagggccaaaacctggaaatcaaagattgggaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - T cell receptor alpha variable 20 - chromosome 3 open reading frame 1 - leucine rich repeat containing 25 - THO complex 6 homolog (Drosophila) |