Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNMB1-potassium large conductance calcium-activated channel, subfamily M, beta member 1 Gene
PTXBC025707
New product
Data sheet of KCNMB1-potassium large conductance calcium-activated channel, subfamily M, beta member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNMB1-potassium large conductance calcium-activated channel, subfamily M, beta member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025707 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNMB1 |
| Origin species: | Human |
| Product name: | KCNMB1-potassium large conductance calcium-activated channel, subfamily M, beta member 1 Gene |
| Size: | 2ug |
| Accessions: | BC025707 |
| Gene id: | 3779 |
| Gene description: | potassium large conductance calcium-activated channel, subfamily M, beta member 1 |
| Synonyms: | BKbeta1; K(VCA)beta; SLO-BETA; hbeta1; hslo-beta; k(VCA)beta-1; slo-beta-1; calcium-activated potassium channel subunit beta-1; BK channel beta subunit 1; BK channel subunit beta-1; MaxiK channel beta-subunit 1; big potassium channel beta subunit 1; calcium-activated potassium channel, subfamily M subunit beta-1; charybdotoxin receptor subunit beta-1; large conductance Ca2+-activated K+ channel beta 1 subunit; maxi K channel subunit beta-1; potassium channel subfamily M regulatory beta subunit 1; potassium large conductance calcium-activated channel, subfamily M, beta member 1; potassium calcium-activated channel subfamily M regulatory beta subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgaagaagctggtgatggcccagaagcggggagagacacgagccctttgcctgggtgtaaccatggtggtgtgtgccgtcatcacctactacatcctggtcacgactgtgctgcccctctaccagaaaagcgtgtggacccaggaatccaagtgccacctgattgagaccaacatcagggaccaggaggagctgaagggcaagaaggtgccccagtacccatgcctgtgggtcaacgtgtcagctgccggcaggtgggctgtgctgtaccacacggaggacactcgggaccagaaccagcaggtactgaactggagggatggggacacatccctttatccctgtcaggtgtgtgagcctgttcctaactgtccctgtccccgaggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) - NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) - NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) - potassium large conductance calcium-activated channel, subfamily M, beta member 2 |