Cart 24 Product Products 2 790,62 € (empty)
-
1 x PAPOLA-pol...121,50 € -
1 x RSPH10B2-r...121,50 € -
1 x PDE4D-phos...113,40 € -
1 x BIN3-bridg...113,40 € -
1 x GALNT3-UDP...113,40 € -
1 x PRKCSH-pro...121,50 € -
1 x KIR3DX1-ki...113,40 € -
1 x CYP20A1-cy...121,50 € -
1 x TUBB2A-tub...121,50 € -
1 x PTPRK-prot...113,40 € -
1 x NDUFA13-NA...113,40 € -
1 x LYZL4-lyso...113,40 € -
1 x GAGE5-G...113,40 € -
1 x NF2-neurof...113,40 € -
1 x BHMT-betai...121,50 € -
1 x PTENP1-pho...121,50 € -
1 x KRT80-kera...121,50 € -
1 x ZFAND5-zin...113,40 € -
1 x ZDHHC6-zin...121,50 € -
1 x BTNL9-buty...121,50 € -
1 x SDHC-succi...113,40 € -
1 x IL1F10-int...113,40 € -
-
No products
To be determined Shipping
2 790,62 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 24 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 790,62 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 790,62 €
View larger 
Data sheet of KCNG1-potassium voltage-gated channel, subfamily G, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNG1-potassium voltage-gated channel, subfamily G, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006367 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNG1 |
| Origin species: | Human |
| Product name: | KCNG1-potassium voltage-gated channel, subfamily G, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC006367 |
| Gene id: | 3755 |
| Gene description: | potassium voltage-gated channel, subfamily G, member 1 |
| Synonyms: | K13; KCNG; KV6.1; kH2; potassium voltage-gated channel subfamily G member 1; potassium channel KH2; potassium channel Kv6.1; potassium channel, voltage gated modifier subfamily G, member 1; potassium voltage-gated channel, subfamily G, member 1; voltage-gated potassium channel subunit Kv6.1; potassium voltage-gated channel modifier subfamily G member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccctcttaccgggagacaattctgactacgactacagcgcgctgagctgcacctcggacgcctccttccacccggccttcctcccgcagcgccaggccatcaagggcgcgttctaccgccgggcgcagcggctgcggccgcaggatgagccccgccagggctgtcagcccgaggaccgccgccgtcggatcatcatcaacgtaggcggcatcaagtactcgctgccctggaccacgctggacgagttcccgctgacgcgcctgggccagctcaaggcctgcaccaacttcgacgacatcctcaacgtgtgcgatgactacgacgtcacctgcaacgagttcttcttcgaccgcaacccgggggccttcggcactatcctgaccttcctgcgcgcgggcaagctgcggctgctgcgcgagatgtgcgcgctgtccttccaggaggagctgctgtactggggcatcgcggaggaccacctggacggctgctgcaagcgccgctacctgcagaagattgaggagttcgcggagatggtggagcgggaggaagaggacgacgcgctggacagcgagggccgcgacagcgagggcccggccgagggcgagggccgcctggggcgctgcatgcggcgactgcgcgacatggtggagaggccgcactcggggctgcctggcaaggtgttcgcctgcctgtcggtgctcttcgtgaccgtcaccgccgtcaacctctccgtcagcaccttgcccagcctgagggaggaggaggagcaggtaagagcccacgccccgcggggaaacgcgccaccacgagggaagggactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 2, subfamily J, polypeptide 2 - immunoglobulin heavy variable 7-81 (non-functional) - DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae) - glutathione peroxidase 4 (phospholipid hydroperoxidase) |