PDLIM7-PDZ and LIM domain 7 (enigma) Gene View larger

PDLIM7-PDZ and LIM domain 7 (enigma) Gene

PTXBC014521

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDLIM7-PDZ and LIM domain 7 (enigma) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDLIM7-PDZ and LIM domain 7 (enigma) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014521
Product type: DNA & cDNA
Ncbi symbol: PDLIM7
Origin species: Human
Product name: PDLIM7-PDZ and LIM domain 7 (enigma) Gene
Size: 2ug
Accessions: BC014521
Gene id: 9260
Gene description: PDZ and LIM domain 7 (enigma)
Synonyms: LMP1; LMP3; PDZ and LIM domain protein 7; 1110003B01Rik; LIM domain protein; LMP; Lim mineralization protein 3; PDZ and LIM domain 7 (enigma); protein enigma; PDZ and LIM domain 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggattccttcaaagtagtgctggaggggccagcaccttggggcttccggctgcaagggggcaaggacttcaatgtgcccctctccatttcccggctcactcctgggggcaaagcggcgcaggccggagtggccgtgggtgactgggtgctgagcatcgatggcgagaatgcgggtagcctcacacacatcgaagctcagaacaagatccgggcctgcggggagcgcctcagcctgggcctcagcagggcccagccggttcagagcaaaccgcagaaggcctccgcccccgccgcggaccctccgcggtacacctttgcacccagcgtctccctcaacaagacggcccggccctttggggcgcccccgcccgctgacagcgccccgcagcagaatggacagccgctccgaccgctggtcccagatgccagcaagcagcggctgatggagaacacagaggactggcggccgcggccggggacaggccagtcgcgttccttccgcatccttgcccacctcacaggcaccgagttcatgcaagacccggatgaggagcacctgaagaaatcaagggaaaagtatgtcctggagctgcagagcccacgctacacccgcctccgggactggcaccaccagcgctctgcccacgtgctcaacgtgcagtcgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hexokinase domain containing 1
- numb homolog (Drosophila)-like
- polo-like kinase 3 (Drosophila)
- polo-like kinase 1 (Drosophila)

Reviews

Buy PDLIM7-PDZ and LIM domain 7 (enigma) Gene now

Add to cart