Cart 22 Product Products 3 255,10 € (empty)
-
1 x Cortisol...339,00 € -
-
1 x KLK10-kall...121,50 € -
-
-
-
1 x HMGN1-high...113,40 € -
1 x ZIM3-zinc...121,50 € -
-
1 x MYL6B-myos...113,40 € -
-
-
-
-
1 x STK32B-ser...121,50 € -
-
-
1 x CAMK1G-cal...121,50 € -
1 x CAPSL-calc...113,40 € -
1 x HIST1H4H-h...113,40 € -
1 x Mas1...259,07 € -
No products
To be determined Shipping
3 255,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 255,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 255,10 €
Data sheet of ZNF26-zinc finger protein 26 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF26-zinc finger protein 26 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008211 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF26 |
| Origin species: | Human |
| Product name: | ZNF26-zinc finger protein 26 Gene |
| Size: | 2ug |
| Accessions: | BC008211 |
| Gene id: | 7574 |
| Gene description: | zinc finger protein 26 |
| Synonyms: | HEL-179; KOX20; zinc finger protein 26; epididymis luminal protein 179; zinc finger protein KOX20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcatacaggagaaaaaccctatcaatgcagtgattgtgggaaagccttcaatatgaagacacaactcattgtacatcagggagttcacacaggaaataatccttatcaatgcggtgaatgtgggaaagcctttggtaggaaggaacagctcactgcacatctgagagctcatgcaggagagaagccctatggatgcagtgaatgtgggaaggctttcagcagcaagtcataccttgttatacataggagaacacacaccggagagagaccctatgaatgtagtttgtgtgagagagccttttgtggaaaatcacagctgattatacatcagagaactcattcaactgagaagccctatgaatgcaatgaatgtgaaaaagcctaccctaggaaggcatcacttcagatacaccagaaaactcattcgggagagaaaccttttaaatgcagtgaatgtggaaaagccttcactcagaagtcatctctcagtgaacatcagagagttcacaccggagagaaaccatggaaatgctctgaatgtgggaaatccttctgttggaattcagggcttcgtatacatcggaagactcataaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - basigin (Ok blood group) - serine dehydratase-like - zinc finger protein 34 - ring finger protein 41 |