> >>PHF15-PHD finger protein 15 Gene
PHF15-PHD finger protein 15 Gene View larger

PHF15-PHD finger protein 15 Gene

PTXBC004292

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of PHF15-PHD finger protein 15 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PHF15-PHD finger protein 15 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004292
Product type: DNA & cDNA
Ncbi symbol: PHF15
Origin species: Human
Product name: PHF15-PHD finger protein 15 Gene
Size: 2ug
Accessions: BC004292
Gene id: 23338
Gene description: PHD finger protein 15
Synonyms: PHF15; JADE-2; protein Jade-2; PHD finger protein 15; jade family PHD finger protein 2; jade family PHD finger 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccatgagcgagtggccactgaacaatgggcaccgcgaggaccctgctccagggctgctgtcagaggaactgctgcaggacgaggagacactgctcagcttcatgcgggacccctcgctgcgacctggtgaccctgctaggaaggcccgaggccgcacccgcctgcctgccaagaagaaaccaccaccaccaccaccgcaggacgggcctggttcacggacgactccagacaaagcccccaagaagacctggggccaggatgcaggcagtggcaaggggggtcaagggccacctaccaggaagccaccacgtcggacatcttctcacttgccgtccagccctgcagccggggactgtcccatcctagccacccctgaaagccccccgccactggcccctgagaccccggacgaggcagcctcagtagctgctgactcagatgtccaagtgcctggccctgcagcaagccctaagcctttgggccggctccggccaccccgcgagagcaaggtaacccggagattgccgggtgccaggcctgatgctgggatgggaccaccttcagctgtggctgagaggcccaagatcagcctgcattttgacactgagactgatggctacttctctgatggggagatgagcgactcagatgtagaggccgaggacggtggggtgcagcggggtccccgggaggcaggggcagaggaggtggtccgcatgggcgtactggcctcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L13
- deoxyguanosine kinase
- germ cell associated 1
- aspartylglucosaminidase

Reviews

Buy PHF15-PHD finger protein 15 Gene now

Add to cart