Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of NTF4-neurotrophin 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NTF4-neurotrophin 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012421 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NTF4 |
| Origin species: | Human |
| Product name: | NTF4-neurotrophin 4 Gene |
| Size: | 2ug |
| Accessions: | BC012421 |
| Gene id: | 4909 |
| Gene description: | neurotrophin 4 |
| Synonyms: | GLC10; GLC1O; NT-4; NT-4/5; NT-5; NT4; NT5; NTF5; neurotrophin-4; neurotrophic factor 4; neurotrophic factor 5; neurotrophin 5 (neurotrophin 4/5); neurotrophin-5; neutrophic factor 4; neurotrophin 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctccctctcccctcatgctccctccccatcctcctccttttcctcctccccagtgtgccaattgagtcccaacccccaccctcaacattgcccccttttctggcccctgagtgggaccttctctccccccgagtagtcctgtctaggggtgcccctgctgggccccctctgctcttcctgctggaggctggggcctttcgggagtcagcaggtgccccggccaaccgcagccggcgtggggtgagcgaaactgcaccagcgagtcgtcggggtgagctggctgtgtgcgatgcagtcagtggctgggtgacagaccgccggaccgctgtggacttgcgtgggcgcgaggtggaggtgttgggcgaggtgcctgcagctggcggcagtcccctccgccagtacttctttgaaacccgctgcaaggctgataacgctgaggaaggtggcccgggggcaggtggagggggctgccggggagtggacaggaggcactgggtatctgagtgcaaggccaagcagtcctatgtgcgggcattgaccgctgatgcccagggccgtgtgggctggcgatggattcgaattgacactgcctgcgtctgcacactcctcagccggactggccgggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - msh homeobox 2 - ALX homeobox 1 - interleukin 33 - periphilin 1 |