PTXBC010893
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC010893 |
Product type: | DNA & cDNA |
Ncbi symbol: | CHMP4A |
Origin species: | Human |
Product name: | CHMP4A-chromatin modifying protein 4A Gene |
Size: | 2ug |
Accessions: | BC010893 |
Gene id: | 29082 |
Gene description: | chromatin modifying protein 4A |
Synonyms: | C14orf123; CHMP4; CHMP4B; HSPC134; SHAX2; SNF7; SNF7-1; VPS32-1; VPS32A; charged multivesicular body protein 4a; SNF7 homolog associated with Alix-2; Snf7 homologue associated with Alix 2; chromatin modifying protein 4A; vacuolar protein sorting-associated protein 32-1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgagtggtctcggcaggctcttcgggaaggggaagaaggagaaagggccaacccctgaagaagcaatacagaaactgaaggagacagagaagatactgatcaagaaacaggaatttttggagcagaagattcaacaggagctacaaacagccaagaagtatgggaccaagaataagagagctgccctacaggctttgcggaggaagaaaagattcgaacagcagctggcacaaactgacgggacattatccaccctggagtttcagcgtgaggccattgagaatgccactaccaatgcagaagtccttcgtaccatggagcttgctgcccaaagcatgaagaaggcctaccaggacatggacattgacaaggtagatgaactgatgactgacatcacggaacaacaggaggtggcccagcagatctcagatgccatttctcggcctatgggctttagagatgatgtggatgaggatgaactgctggaggagctagaggagctggagcaggaggaattggcccaggagttgttaaatgtgggcgacaaggaagaagaaccctcagtcaaattgcctagtgtaccttctactcatctgccggcagggccagctcccaaagtggatgaagatgaagaagcactaaagcagttggctgagtgggtatcctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - nicotinamide N-methyltransferase - transmembrane protein 59-like - tripartite motif-containing 44 - tripartite motif-containing 47 |