Cart 19 Product Products 2 457,38 € (empty)
-
1 x C13orf3-ch...121,50 € -
1 x HIST4H4-hi...113,40 € -
1 x POU5F2-POU...121,50 € -
-
1 x COX7C-cyto...113,40 € -
1 x C13orf31-c...121,50 € -
1 x GTPBP8-GTP...113,40 € -
1 x NSMCE4A-no...121,50 € -
-
1 x C19orf25-c...113,40 € -
1 x EIF3K-euka...113,40 € -
1 x CAPNS1-cal...121,50 € -
1 x MARK4-MAP/...113,40 € -
1 x HSD17B11-h...121,50 € -
1 x GORASP1-go...121,50 € -
1 x RMND5A-req...121,50 € -
1 x MIPOL1-mir...113,40 € -
1 x GMDS-GDP-m...121,50 € -
1 x DSTN-destr...113,40 €
No products
To be determined Shipping
2 457,38 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 457,38 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 457,38 €
Data sheet of MRPL4-mitochondrial ribosomal protein L4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL4-mitochondrial ribosomal protein L4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000756 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL4 |
| Origin species: | Human |
| Product name: | MRPL4-mitochondrial ribosomal protein L4 Gene |
| Size: | 2ug |
| Accessions: | BC000756 |
| Gene id: | 51073 |
| Gene description: | mitochondrial ribosomal protein L4 |
| Synonyms: | CGI-28; L4mt; 39S ribosomal protein L4, mitochondrial; MRP-L4; mitochondrial ribosomal protein L4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcagttcgtccgggccggggcgcgggcctggcttcggcctaccggcagccagggcctgagttccctggcggaagaggcagcgcgtgcgaccgagaacccggagcaggtggcgagcgagggtctcccggagcccgtgctgcgcaaagtcgagctcccggtacccactcatcgacgcccagtgcaggcctgggtcgagtccttgcggggcttcgagcaggagcgcgtgggcctggccgacctgcaccccgatgttttcgccaccgcgcccaggctggacatactgcaccaggttgctatgtggcagaagaacttcaagagaattagctatgccaagaccaagacgagagccgaggtgcggggcggtggccggaagccttggccgcagaaaggcactgggcgggcccggcatggcagcatccgctctccgctctggcgaggaggaggtgttgcccatggcccccggggccccacaagttactactacatgctgcccatgaaggtgcgggcgctgggtctcaaagtggcactgaccgtcaagctggcccaggacgacctgcacatcatggactccctagagctgcccaccggagacccacagtacctgacagagctggcgcactaccgccgctggggggactccgtactcctcgtggacttaacacacgaggagatgccacagagcatcgtggaggccacctctaggcttaagaccttcaacttgatcccggctgttggtgagcaaagagcccaggcccctagagtgcgcatgtgcaggctccgctgttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - HLA-B associated transcript 2-like - pirin (iron-binding nuclear protein) - T cell receptor alpha variable 20 - chromosome 3 open reading frame 1 |