> >>FKBP11-FK506 binding protein 11, 19 kDa Gene
FKBP11-FK506 binding protein 11, 19 kDa Gene View larger

FKBP11-FK506 binding protein 11, 19 kDa Gene

PTXBC027973

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of FKBP11-FK506 binding protein 11, 19 kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FKBP11-FK506 binding protein 11, 19 kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027973
Product type: DNA & cDNA
Ncbi symbol: FKBP11
Origin species: Human
Product name: FKBP11-FK506 binding protein 11, 19 kDa Gene
Size: 2ug
Accessions: BC027973
Gene id: 51303
Gene description: FK506 binding protein 11, 19 kDa
Synonyms: PPIase FKBP11; peptidyl-prolyl cis-trans isomerase FKBP11; 19 kDa FK506-binding protein; 19 kDa FKBP; FK506 binding protein 11, 19 kDa; FKBP-11; FKBP-19; rotamase; FK506 binding protein 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctgcgcccctcactcctcccgctccatctgctgctgctgctgctgctcagtgcggcggtgtgccgggctgaggctgggctcgaaaccgaaagtcccgtccggaccctccaagtggagaccctggtggagcccccagaaccatgtgccgagcccgctgcttttggagacacgcttcacatacactacacgggaagcttggtagatggacgtattattgacacctccctgaccagagaccctctggttatagaacttggccaaaagcaggtgattccaggtctggagcagagtcttctcgacatgtgtgtgggagagaagcgaagggcaatcattccttctcacttggcctatggaaaacggggatttccaccatctgtcccagcggatgcagtggtgcagtatgacgtggagctgattgcactaatccgagccaactactggctaaagctggtgaagggcattttgcctctggtagggatggccatggtgccagccctcctgggcctcattgggtatcacctatacagaaaggccaatagacccaaagtctccaaaaagaagctcaaggaagagaaacgaaacaagagcaaaaagaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 44
- interleukin 12 receptor, beta 1
- coiled-coil domain containing 49
- coiled-coil domain containing 99

Reviews

Buy FKBP11-FK506 binding protein 11, 19 kDa Gene now

Add to cart