Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HSD17B10-hydroxysteroid (17-beta) dehydrogenase 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HSD17B10-hydroxysteroid (17-beta) dehydrogenase 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000372 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HSD17B10 |
| Origin species: | Human |
| Product name: | HSD17B10-hydroxysteroid (17-beta) dehydrogenase 10 Gene |
| Size: | 2ug |
| Accessions: | BC000372 |
| Gene id: | 3028 |
| Gene description: | hydroxysteroid (17-beta) dehydrogenase 10 |
| Synonyms: | 17b-HSD10; ABAD; CAMR; DUPXp11.22; ERAB; HADH2; HCD2; MHBD; MRPP2; MRX17; MRX31; MRXS10; SCHAD; SDR5C1; 3-hydroxyacyl-CoA dehydrogenase type-2; 3-hydroxy-2-methylbutyryl-CoA dehydrogenase; AB-binding alcohol dehydrogenase; amyloid-beta peptide binding alcohol dehydrogenase; endoplasmic reticulum-associated amyloid beta-peptide-binding protein; mitochondrial RNase P subunit 2; mitochondrial ribonuclease P protein 2; short chain L-3-hydroxyacyl-CoA dehydrogenase type 2; short chain type dehydrogenase/reductase XH98G2; hydroxysteroid 17-beta dehydrogenase 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagcagcgtgtcggagcgtgaagggcctggtggcggtaataaccggaggagcctcgggcctgggcctggccacggcggagcgacttgtggggcagggagcctctgctgtgcttctggacctgcccaactcgggtggggaggcccaagccaagaagttaggaaacaactgcgttttcgccccagccgacgtgacctctgagaaggatgtgcaaacagctctggctctagcaaaaggaaagtttggccgtgtggatgtagctgtcaactgtgcaggcatcgcggtggctagcaagacgtacaacttaaagaagggccagacccataccttggaagacttccagcgagttcttgatgtgaatctcatgggcaccttcaatgtgatccgcctggtggctggtgagatgggccagaatgaaccagaccagggaggccaacgtggggtcatcatcaacactgccagtgtggctgccttcgagggtcaggttggacaagctgcatactctgcttccaaggggggaatagtgggcatgacactgcccattgctcgggatctggctcccataggtatccgggtgatgaccattgccccaggtctgtttggcaccccactgctgaccagcctcccagagaaagtgtgcaacttcttggccagccaagtgcccttccctagccgactgggtgaccctgctgagtatgctcacctcgtacaggccatcatcgagaacccattcctcaatggagaggtcatccggctggatggggccattcgtatgcagccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily C, member 3 - aldehyde dehydrogenase 3 family, member B1 - DnaJ (Hsp40) homolog, subfamily B, member 8 - DnaJ (Hsp40) homolog, subfamily A, member 3 |