Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of WBP2NL-WBP2 N-terminal like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about WBP2NL-WBP2 N-terminal like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022549 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WBP2NL |
| Origin species: | Human |
| Product name: | WBP2NL-WBP2 N-terminal like Gene |
| Size: | 2ug |
| Accessions: | BC022549 |
| Gene id: | 164684 |
| Gene description: | WBP2 N-terminal like |
| Synonyms: | GRAMD7; PAWP; postacrosomal sheath WW domain-binding protein; WW domain-binding protein 2-like; WBP2 N-terminal like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggtgaatcagagccacaccgagaaccgccgcggagccctcatccctaacggtgaaagtctcttgaagcggtctccgaatgtggagctctccttcccacagcgatcagaaggctcaaatgtctttagtggtagaaagacaggaacattgtttctcacttcataccgggtgattttcataacttcatgctccatcagtgatcccatgttgtcttttatgatgccatttgatctgatgacgaacctcactgttgaacaaccagtatttgctgcaaacttcattaagggaactattcaggcagctccatatggtggctgggaaggacaagctacttttaaattagtcttcagaaatggaggtgccattgaatttgcccagttgatggtgaaagctgcctctgctgctgcccgaggatttccacttagaaccttaaatgactggttcagctctatgggaatttatgtaattactgggaagggaatatgtgcactccacagatgccttgttcagttattgtctatggagccccacctgcaggatatggagccccacctcccggatacggagccccacctgcaggatatggagcccaacccgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PHD finger protein 15 - ribosomal protein L13 - deoxyguanosine kinase - germ cell associated 1 |