C10orf65-chromosome 10 open reading frame 65 Gene View larger

C10orf65-chromosome 10 open reading frame 65 Gene

PTXBC011916

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf65-chromosome 10 open reading frame 65 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf65-chromosome 10 open reading frame 65 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011916
Product type: DNA & cDNA
Ncbi symbol: C10orf65
Origin species: Human
Product name: C10orf65-chromosome 10 open reading frame 65 Gene
Size: 2ug
Accessions: BC011916
Gene id: 112817
Gene description: chromosome 10 open reading frame 65
Synonyms: C10orf65; DHDPS2; DHDPSL; HP3; NPL2; 4-hydroxy-2-oxoglutarate aldolase, mitochondrial; DHDPS-like protein; N-acetylneuraminate pyruvate lyase 2 (putative); dihydrodipicolinate synthase-like, mitochondrial; dihydrodipicolinate synthetase homolog 2; protein 569272; 4-hydroxy-2-oxoglutarate aldolase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgggtccccaagtctggtcttctgtgaggcaggggctaagcaggagcttgtccaggaatgtgggggtctgggcctcaggggaggggaagaaggtggacattgcgggtatctacccccctgtgaccacccccttcactgccactgcagaggtggactatgggaaactggaggagaatctgcacaaactgggcaccttccccttccgaggagctgtggggggcgtctgcgccctggccaatgtcctgggggctcaggtgtgccagctggagcgactgtgctgcacggggcaatgggaagatgcccagaaactgcagcaccgcctcattgagccaaacgctgcggtgacccggcgctttgggatcccagggctgaagaaaatcatggactggtttggctactatggaggcccctgccgcgcccccttgcaggagctgagccccgctgaggaggaggcactgcgcatggatttcaccagcaacggctggctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 17 open reading frame 70
- zinc finger, DHHC-type containing 19
- peroxisomal biogenesis factor 11 beta
- chromosome 20 open reading frame 20

Reviews

Buy C10orf65-chromosome 10 open reading frame 65 Gene now

Add to cart