SRGN-serglycin Gene View larger

SRGN-serglycin Gene

PTXBC015516

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SRGN-serglycin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SRGN-serglycin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015516
Product type: DNA & cDNA
Ncbi symbol: SRGN
Origin species: Human
Product name: SRGN-serglycin Gene
Size: 2ug
Accessions: BC015516
Gene id: 5552
Gene description: serglycin
Synonyms: PPG; PRG; PRG1; serglycin; hematopoetic proteoglycan core peptide; hematopoetic proteoglycan core protein; hematopoietic proteoglycan core protein; p.PG; platelet proteoglycan core protein; proteoglycan 1, secretory granule; proteoglycan protein core for mast cell secretory granule; secretory granule proteoglycan core peptide; secretory granule proteoglycan core protein; serglycin proteoglycan
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgcagaagctactcaaatgcagtcggcttgtcctggctcttgccctcatcctggttctggaatcctcagttcaaggttatcctacgcagagagccaggtaccaatgggtgcgctgcaatccagacagtaattctgcaaactgccttgaagaaaaaggaccaatgttcgaactacttccaggtgaatccaacaagatcccccgtctgaggactgacctttttccaaagacgagaatccaggacttgaatcgtatcttcccactttctgaggactactctggatcaggcttcggctccggctccggctctggatcaggatctgggagtggcttcctaacggaaatggaacaggattaccaactagtagacgaaagtgatgctttccatgacaaccttaggtctcttgacaggaatctgccctcagacagccaggacttgggtcaacatggattagaagaggattttatgttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tektin 1
- cortactin
- nidogen 1
- copine V

Reviews

Buy SRGN-serglycin Gene now

Add to cart