Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MS4A15-membrane-spanning 4-domains, subfamily A, member 15 Gene
PTXBC031610
New product
Data sheet of MS4A15-membrane-spanning 4-domains, subfamily A, member 15 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MS4A15-membrane-spanning 4-domains, subfamily A, member 15 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031610 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MS4A15 |
| Origin species: | Human |
| Product name: | MS4A15-membrane-spanning 4-domains, subfamily A, member 15 Gene |
| Size: | 2ug |
| Accessions: | BC031610 |
| Gene id: | 219995 |
| Gene description: | membrane-spanning 4-domains, subfamily A, member 15 |
| Synonyms: | membrane-spanning 4-domains subfamily A member 15; membrane spanning 4-domains A15 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttcgccgcggccacgtgggcatcttcttcatcgagggcggcgtccccttctggggaggagcctgcttcatcatctccggatccctctcagtggcagccgagaagaaccacaccagttgcctggtgaggagcagcctgggcaccaacatcctcagcgtcatggcggcctttgctgggacagccattctgctcatggattttggtgttaccaaccgggatgtggacaggggctatctggccgtgcttactatcttcactgtcctggagttcttcacagcggtcattgccatgcacttcgggtgccaagccatccatgcccaggccagtgcacctgtgatcttcctgccaaacgccttcagcgcagacttcaacatccccagcccggcagcctctgcgccccctgcctatgacaatgtggcatatgcccaaggagtcgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dynein, cytoplasmic 2, light intermediate chain 1 - low density lipoprotein receptor adaptor protein 1 - neural proliferation, differentiation and control, 1 - proteasome (prosome, macropain) assembly chaperone 1 |