ALKBH3-alkB, alkylation repair homolog 3 (E. coli) Gene View larger

ALKBH3-alkB, alkylation repair homolog 3 (E. coli) Gene

PTXBC015155

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALKBH3-alkB, alkylation repair homolog 3 (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALKBH3-alkB, alkylation repair homolog 3 (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015155
Product type: DNA & cDNA
Ncbi symbol: ALKBH3
Origin species: Human
Product name: ALKBH3-alkB, alkylation repair homolog 3 (E. coli) Gene
Size: 2ug
Accessions: BC015155
Gene id: 221120
Gene description: alkB, alkylation repair homolog 3 (E. coli)
Synonyms: ABH3; DEPC-1; DEPC1; PCA1; hABH3; alpha-ketoglutarate-dependent dioxygenase alkB homolog 3; alkB homolog 3, alpha-ketoglutarate-dependent dioxygenase; alkB, alkylation repair homolog 3; alkylated DNA repair protein alkB homolog 3; prostate cancer antigen-1; alkB homolog 3, alpha-ketoglutaratedependent dioxygenase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaccaaatcctcactggcaccctgtgctgcgcacactaaagaaccgcattgaagagaacactggccacaccttcaactccttactctgcaatctttatcgcaatgagaaggacagcgtggactggcacagtgatgatgaaccctcactagggaggtgccccattattgcttcactaagttttggtgccacacgcacatttgagatgagaaagaagccaccaccagaagagaatggagactacacatatgtggaaagagtgaagatacccttggatcatggtaccttgttaatcatggaaggagcgacacaagctgactggcagcatcgagtgcccaaagaataccactctagagaaccgagagtgaacctgacctttcggacagtctatccagaccctcgaggggcaccctggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxysteroid (17-beta) dehydrogenase 10
- DnaJ (Hsp40) homolog, subfamily C, member 3
- aldehyde dehydrogenase 3 family, member B1
- DnaJ (Hsp40) homolog, subfamily B, member 8

Reviews

Buy ALKBH3-alkB, alkylation repair homolog 3 (E. coli) Gene now

Add to cart