Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ALKBH3-alkB, alkylation repair homolog 3 (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ALKBH3-alkB, alkylation repair homolog 3 (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015155 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ALKBH3 |
| Origin species: | Human |
| Product name: | ALKBH3-alkB, alkylation repair homolog 3 (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC015155 |
| Gene id: | 221120 |
| Gene description: | alkB, alkylation repair homolog 3 (E. coli) |
| Synonyms: | ABH3; DEPC-1; DEPC1; PCA1; hABH3; alpha-ketoglutarate-dependent dioxygenase alkB homolog 3; alkB homolog 3, alpha-ketoglutarate-dependent dioxygenase; alkB, alkylation repair homolog 3; alkylated DNA repair protein alkB homolog 3; prostate cancer antigen-1; alkB homolog 3, alpha-ketoglutaratedependent dioxygenase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaccaaatcctcactggcaccctgtgctgcgcacactaaagaaccgcattgaagagaacactggccacaccttcaactccttactctgcaatctttatcgcaatgagaaggacagcgtggactggcacagtgatgatgaaccctcactagggaggtgccccattattgcttcactaagttttggtgccacacgcacatttgagatgagaaagaagccaccaccagaagagaatggagactacacatatgtggaaagagtgaagatacccttggatcatggtaccttgttaatcatggaaggagcgacacaagctgactggcagcatcgagtgcccaaagaataccactctagagaaccgagagtgaacctgacctttcggacagtctatccagaccctcgaggggcaccctggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hydroxysteroid (17-beta) dehydrogenase 10 - DnaJ (Hsp40) homolog, subfamily C, member 3 - aldehyde dehydrogenase 3 family, member B1 - DnaJ (Hsp40) homolog, subfamily B, member 8 |