IMP3-IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene View larger

IMP3-IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene

PTXBC006487

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IMP3-IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IMP3-IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006487
Product type: DNA & cDNA
Ncbi symbol: IMP3
Origin species: Human
Product name: IMP3-IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene
Size: 2ug
Accessions: BC006487
Gene id: 55272
Gene description: IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Synonyms: IMP3, U3 small nucleolar ribonucleoprotein; U3 snoRNP protein IMP3; IMP3, U3 small nucleolar ribonucleoprotein, homolog; U3 small nucleolar ribonucleoprotein protein IMP3; BRMS2; C15orf12; MRPS4; U3 snoRNP protein 3 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcggaagcttaagttccacgagcagaagctgctgaagcaggtggacttcctgaactgggaggtcaccgaccacaacctgcacgagctgcgcgtgctgcggcgttaccggctgcagcggcgggaggactacacgcgctacaaccagctgagccgtgccgtgcgtgagctggcgcggcgcctgcgcgacctgcccgaacgcgaccagttccgcgtgcgcgcttcggccgcgctgctggacaagctgtatgctctcggcttggtgcccacgcgcggttcgctggagctctgcgacttcgtcacggcctcgtccttctgccgccgccgcctccccaccgtgctcctcaagctgcgcatggcgcagcaccttcaggctgcagtggcctttgtggagcaagggcacgtacgcgtgggccctgacgtggttaccgaccccgccttccttgtcacgcgcagcatggaggactttgtcacttgggtggactcgtccaagatcaagcggcacgtgctagagtacaatgaggagcgcgatgacttcgatctggaagcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
- solute carrier family 1 (glutamate transporter), member 7

Reviews

Buy IMP3-IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene now

Add to cart