Cart 5 Product Products 574,42 € (empty)
-
1 x IMPACT-Imp...121,50 € -
-
1 x C4orf12-ch...113,40 € -
-
1 x REXO1L2P-R...121,50 €
No products
To be determined Shipping
574,42 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 574,42 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 574,42 €
View larger 
RARRES3-retinoic acid receptor responder (tazarotene induced) 3 Gene
PTXBC009678
New product
Data sheet of RARRES3-retinoic acid receptor responder (tazarotene induced) 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RARRES3-retinoic acid receptor responder (tazarotene induced) 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009678 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RARRES3 |
| Origin species: | Human |
| Product name: | RARRES3-retinoic acid receptor responder (tazarotene induced) 3 Gene |
| Size: | 2ug |
| Accessions: | BC009678 |
| Gene id: | 5920 |
| Gene description: | retinoic acid receptor responder (tazarotene induced) 3 |
| Synonyms: | HRASLS4; HRSL4; PLA1/2-3; RIG1; TIG3; retinoic acid receptor responder protein 3; HRAS-like suppressor 4; RAR-responsive protein TIG3; retinoic acid receptor responder (tazarotene induced) 3; retinoic acid-inducible gene 1; retinoid-inducible gene 1 protein; tazarotene-induced gene 3 protein; retinoic acid receptor responder 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttcgccacaccaagagcccaaacctggagacctgattgagattttccgccttggctatgagcactgggccctgtatataggagatggctacgtgatccatctggctcctccaagtgagtaccccggggctggctcctccagtgtcttctcagtcctgagcaacagtgcagaggtgaaacgggagcgcctggaagatgtggtgggaggctgttgctatcgggtcaacaacagcttggaccatgagtaccaaccacggcccgtggaggtgatcatcagttctgcgaaggagatggttggtcagaagatgaagtacagtattgtgagcaggaactgtgagcactttgtcacccagctgagatatggcaagtcccgctgtaaacaggtggaaaaggccaaggttgaagtcggtgtggccacggcgcttggaatcctggttgttgctggatgctcttttgcgattaggagataccaaaaaaaagcgacagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane emp24 protein transport domain containing 9 - protein phosphatase 1D magnesium-dependent, delta isoform - protein phosphatase 1D magnesium-dependent, delta isoform - neuroblastoma breakpoint family, member 22 (pseudogene) |