Cart 8 Product Products 915,30 € (empty)
-
1 x ACSM5-acyl...113,40 € -
1 x C1orf211-c...113,40 € -
1 x FCGR3A-Fc...113,40 € -
1 x DPY19L3-dp...113,40 € -
1 x FTH1-ferri...113,40 € -
1 x FAM118B-fa...121,50 € -
1 x HLA-DQB1-m...113,40 € -
1 x COMMD2-COM...113,40 €
No products
To be determined Shipping
915,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 915,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 915,30 €
View larger 
LSM4-LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
PTXBC000387
New product
Data sheet of LSM4-LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LSM4-LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000387 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LSM4 |
| Origin species: | Human |
| Product name: | LSM4-LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC000387 |
| Gene id: | 25804 |
| Gene description: | LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
| Synonyms: | LSM4 homolog, U6 small nuclear RNA and mRNA degradation associated; LSM4 homolog, U6 small nuclear RNA associated; LSM4 U6 small nuclear RNA and mRNA degradation associated; U6 snRNA-associated Sm-like protein LSm4; GRP; YER112W; glycine-rich protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttcccttgtcactgctgaagacggctcagaatcaccccatgttggtggagctgaaaaatggggagacgtacaatggacacctggtgagctgcgacaactggatgaacattaacctgcgagaagtcatctgcacgtccagggacggggacaagttctggcggatgcccgagtgctacatccgcggcagcaccatcaagtacctgcgcatccccgacgagatcatcgacatggtcaaggaggaggtggtggccaagggccgcggccgcggaggcctgcagcagcagaagcagcagaaaggccgcggcatgggcggcgctggccgaggtgtgtttggtggccggggccgaggtgggatcccgggcacaggcagaggccagccagagaagaagcctggcagacaggcgggcaaacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myosin, light chain 6B, alkali, smooth muscle and non-muscle - proline-serine-threonine phosphatase interacting protein 2 - serpin peptidase inhibitor, clade B (ovalbumin), member 1 - synovial sarcoma translocation gene on chromosome 18-like 1 |