Cart 22 Product Products 2 883,34 € (empty)
-
1 x NFKBIE-nuc...121,50 € -
1 x ZFYVE26-zi...121,50 € -
1 x ZNF124-zin...121,50 € -
1 x Gas8...259,07 € -
1 x SOD1-super...113,40 € -
1 x P2RX4-puri...121,50 € -
1 x RBBP4-reti...121,50 € -
1 x LYPD5-LY6/...113,40 € -
1 x FANCA-Fanc...121,50 € -
1 x ZPBP-zona...121,50 € -
1 x DUSP26-dua...113,40 € -
1 x GCSH-glyci...113,40 € -
1 x PLEKHO2-pl...121,50 € -
1 x MMP13-matr...121,50 € -
1 x BST2-bone...113,40 € -
1 x SURF6-surf...121,50 € -
1 x RPS16-ribo...113,40 € -
1 x RPL13-ribo...113,40 € -
1 x RPSA-ribos...121,50 € -
1 x LRP3...259,07 € -
1 x GINS2-GINS...113,40 € -
1 x TUBA3E-tub...121,50 €
No products
To be determined Shipping
2 883,34 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 883,34 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 883,34 €
Data sheet of PNOC-prepronociceptin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PNOC-prepronociceptin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034758 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PNOC |
| Origin species: | Human |
| Product name: | PNOC-prepronociceptin Gene |
| Size: | 2ug |
| Accessions: | BC034758 |
| Gene id: | 5368 |
| Gene description: | prepronociceptin |
| Synonyms: | N/OFQ; NOP; OFQ; PPNOC; ppN/OFQ; prepronociceptin; nociceptin; nocistatin; orphanin FQ; pre-pro-N/OFQ; pronociceptin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagtcctgctttgtgacctgctgctgctcagtctcttctccagtgtgttcagcagttgtcagagggactgtctcacatgccaggagaagctccacccagccctggacagcttcgacctggaggtgtgcatcctcgagtgtgaagagaaggtcttccccagccccctctggactccatgcaccaaggtcatggccaggagctcttggcagctcagccctgccgccccagagcatgtggcggctgctctctaccagccgagagcttcggagatgcagcatctgcggcgaatgccccgagtccggagcttgttccaggagcaggaagagcccgagcctggcatggaggaggctggtgagatggagcagaagcagctgcagaagagatttgggggcttcaccggggcccggaagtcggccaggaagttggccaatcagaagcggttcagtgagtttatgaggcaatacttggtcctgagcatgcagtccagccagcgccggcgcaccctgcaccagaatggtaatgtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytokine-like 1 - tubulin, beta 6 - F-box protein 9 - proline rich 16 |