Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of EIF5A-eukaryotic translation initiation factor 5A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF5A-eukaryotic translation initiation factor 5A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000751 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF5A |
| Origin species: | Human |
| Product name: | EIF5A-eukaryotic translation initiation factor 5A Gene |
| Size: | 2ug |
| Accessions: | BC000751 |
| Gene id: | 1984 |
| Gene description: | eukaryotic translation initiation factor 5A |
| Synonyms: | EIF-5A; EIF5A1; eIF5AI; eukaryotic translation initiation factor 5A-1; eIF-4D; eIF-5A-1; eIF-5A1; eukaryotic initiation factor 5A; rev-binding factor; eukaryotic translation initiation factor 5A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagatgacttggacttcgagacaggagatgcaggggcctcagccaccttcccaatgcagtgctcagcattacgtaagaatggctttgtggtgctcaaaggccggccatgtaagatcgtcgagatgtctacttcgaagactggcaagcacggccacgccaaggtccatctggttggtattgacatctttactgggaagaaatatgaagatatctgcccgtcaactcataatatggatgtccccaacatcaaaaggaatgacttccagctgattggcatccaggatgggtacctatcactgctccaggacagcggggaggtacgagaggaccttcgtctccctgagggagaccttggcaaggagattgagcagaagtacgactgtggagaagagatcctgatcacggtgctgtctgccatgacagaggaggcagctgttgcaatcaaggccatggcaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nucleolar and spindle associated protein 1 - translocation associated membrane protein 2 - WW domain containing adaptor with coiled-coil - leucine zipper, putative tumor suppressor 2 |