PTXBC000751
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC000751 |
Product type: | DNA & cDNA |
Ncbi symbol: | EIF5A |
Origin species: | Human |
Product name: | EIF5A-eukaryotic translation initiation factor 5A Gene |
Size: | 2ug |
Accessions: | BC000751 |
Gene id: | 1984 |
Gene description: | eukaryotic translation initiation factor 5A |
Synonyms: | EIF-5A; EIF5A1; eIF5AI; eukaryotic translation initiation factor 5A-1; eIF-4D; eIF-5A-1; eIF-5A1; eukaryotic initiation factor 5A; rev-binding factor; eukaryotic translation initiation factor 5A |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcagatgacttggacttcgagacaggagatgcaggggcctcagccaccttcccaatgcagtgctcagcattacgtaagaatggctttgtggtgctcaaaggccggccatgtaagatcgtcgagatgtctacttcgaagactggcaagcacggccacgccaaggtccatctggttggtattgacatctttactgggaagaaatatgaagatatctgcccgtcaactcataatatggatgtccccaacatcaaaaggaatgacttccagctgattggcatccaggatgggtacctatcactgctccaggacagcggggaggtacgagaggaccttcgtctccctgagggagaccttggcaaggagattgagcagaagtacgactgtggagaagagatcctgatcacggtgctgtctgccatgacagaggaggcagctgttgcaatcaaggccatggcaaaataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - nucleolar and spindle associated protein 1 - translocation associated membrane protein 2 - WW domain containing adaptor with coiled-coil - leucine zipper, putative tumor suppressor 2 |