AHNAK-AHNAK nucleoprotein Gene View larger

AHNAK-AHNAK nucleoprotein Gene

PTXBC000926

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AHNAK-AHNAK nucleoprotein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AHNAK-AHNAK nucleoprotein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000926
Product type: DNA & cDNA
Ncbi symbol: AHNAK
Origin species: Human
Product name: AHNAK-AHNAK nucleoprotein Gene
Size: 2ug
Accessions: BC000926
Gene id: 79026
Gene description: AHNAK nucleoprotein
Synonyms: AHNAK nucleoprotein; AHNAK-related; neuroblast differentiation-associated protein AHNAK; AHNAKRS; PM227; desmoyokin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaaggaggaggagacaacccgggagctgctgctgcccaactggcagggtagtggctcccacgggctgaccatcgcccagagggacgacggcgtctttgtgcaggaggtgacgcagaactcccctgcggcccgcactggggtggtcaaggagggggaccagattgtgggtgccaccatctactttgacaacctgcagtcgggtgaggtgacccagctgctgaacaccatggggcaccacacggtgggcctgaagctgcaccgcaagggggaccgctctcccgagcctggccagacctggacccgtgaagtcttcagctcctgcagctctgaagtggttctgaacacaccacagccatcagcactggaatgcaaagaccagaacaaacagaaggaagccagcagccaagccggggcagtttcagtctccaccccaaatgcaggactgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WD repeat domain 85
- WD repeat domain 32
- carbonyl reductase 1
- ribosomal protein S2

Reviews

Buy AHNAK-AHNAK nucleoprotein Gene now

Add to cart