NUMB-numb homolog (Drosophila) Gene View larger

NUMB-numb homolog (Drosophila) Gene

PTXBC033824

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUMB-numb homolog (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUMB-numb homolog (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033824
Product type: DNA & cDNA
Ncbi symbol: NUMB
Origin species: Human
Product name: NUMB-numb homolog (Drosophila) Gene
Size: 2ug
Accessions: BC033824
Gene id: 8650
Gene description: numb homolog (Drosophila)
Synonyms: NUMB, endocytic adaptor protein; numb homolog; h-Numb; protein numb homolog; C14orf41; S171; c14_5527
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccctatccagcccctaatgtgcctgtggtgggcatcactccctcccagatggtggccaacgtatttggcactgcaggccaccctcaggctgcccatccccatcagtcacccagcctggtcaggcagcagacattccctcactacgaggcaagcagtgctaccaccagtcccttctttaagcctcctgctcagcacctcaacggttctgcagctttcaatggtgtagatgatggcaggttggcctcagcagacaggcatacagaggttcctacaggcacctgcccagtggatccttttgaagcccagtgggctgcattagaaaataagtccaagcagcgtactaatccctcccctaccaaccctttctccagtgacttacagaagacgtttgaaattgaactttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glycoprotein IX (platelet)
- 6-phosphogluconolactonase
- CUE domain containing 2
- zinc finger protein 414

Reviews

Buy NUMB-numb homolog (Drosophila) Gene now

Add to cart