Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MUM1-melanoma associated antigen (mutated) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MUM1-melanoma associated antigen (mutated) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019585 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MUM1 |
| Origin species: | Human |
| Product name: | MUM1-melanoma associated antigen (mutated) 1 Gene |
| Size: | 2ug |
| Accessions: | BC019585 |
| Gene id: | 84939 |
| Gene description: | melanoma associated antigen (mutated) 1 |
| Synonyms: | PWWP domain-containing protein MUM1; EXPAND1; HSPC211; MUM-1; melanoma ubiquitous mutated protein; mutated melanoma-associated antigen 1; protein expandere; melanoma associated antigen (mutated) 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccagggttccagggcccggtggcctgggagctgctttctccccactggctgggctgcatctggccctggctggaggccttgctttgaggggctgtgaccctcttcccccaggccctccccagccgacgacagccaccggagaggagatcggaacacgattgtctcagatgcagggcgctgtgcgggacgaagccgcaaggactctcgtatcgggcccttgggactcgggaggtgccagaggcggcggctgctctggacctcggtgttcactgacctttgtttcacttgcctctgctcgactccgagagcaggaaacccggccgtggcctggcagctccgcctcccatgcccgcacgctggggtctgtcttgtctggagcagtggggcacaccccggaggaggcgggggtcagggctgtcggccttggccccctgctggtcgctgtttcggggactcggggcggccagtaccaccgcctgaggcggggctcagcagcgttgcatgtacgggcctcgtactgcctcatggaaaatcctccggagccgccctccattgtgggttcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 10 open reading frame 65 - chromosome 17 open reading frame 70 - zinc finger, DHHC-type containing 19 - peroxisomal biogenesis factor 11 beta |